FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639774_at:

>probe:Drosophila_2:1639774_at:692:683; Interrogation_Position=109; Antisense; TATCCTGGCCAGTGCTACTACGAGG
>probe:Drosophila_2:1639774_at:270:665; Interrogation_Position=124; Antisense; TACTACGAGGAGCTCAACCAGGCCA
>probe:Drosophila_2:1639774_at:396:201; Interrogation_Position=139; Antisense; AACCAGGCCATACCCAAGAAACAGT
>probe:Drosophila_2:1639774_at:685:389; Interrogation_Position=156; Antisense; GAAACAGTCCTACAAGCCCATCAAT
>probe:Drosophila_2:1639774_at:157:435; Interrogation_Position=184; Antisense; GAGGGCTACTGCCAGTCCATCTACT
>probe:Drosophila_2:1639774_at:113:351; Interrogation_Position=209; Antisense; GCAGACCAGACTATGTCCTCGAAAT
>probe:Drosophila_2:1639774_at:718:393; Interrogation_Position=229; Antisense; GAAATTAGCTATTGCGGTCGCCATA
>probe:Drosophila_2:1639774_at:448:501; Interrogation_Position=245; Antisense; GTCGCCATAATTTGGTGCCCACGGA
>probe:Drosophila_2:1639774_at:676:109; Interrogation_Position=269; Antisense; AGAAGTGCAGGATCGCCTCGGATAT
>probe:Drosophila_2:1639774_at:541:21; Interrogation_Position=290; Antisense; ATATGCGACGCACCTTTCCGGAATG
>probe:Drosophila_2:1639774_at:409:233; Interrogation_Position=311; Antisense; AATGCTGTCCCAAGCTGGTGTGCCA
>probe:Drosophila_2:1639774_at:103:551; Interrogation_Position=336; Antisense; GGAGTCCGAGAGCAACTACATCTAG
>probe:Drosophila_2:1639774_at:167:545; Interrogation_Position=72; Antisense; GGATCTTACCTACCGCGGAAATGCA
>probe:Drosophila_2:1639774_at:124:233; Interrogation_Position=91; Antisense; AATGCAGTGCATCCAGACTATCCTG

Paste this into a BLAST search page for me
TATCCTGGCCAGTGCTACTACGAGGTACTACGAGGAGCTCAACCAGGCCAAACCAGGCCATACCCAAGAAACAGTGAAACAGTCCTACAAGCCCATCAATGAGGGCTACTGCCAGTCCATCTACTGCAGACCAGACTATGTCCTCGAAATGAAATTAGCTATTGCGGTCGCCATAGTCGCCATAATTTGGTGCCCACGGAAGAAGTGCAGGATCGCCTCGGATATATATGCGACGCACCTTTCCGGAATGAATGCTGTCCCAAGCTGGTGTGCCAGGAGTCCGAGAGCAACTACATCTAGGGATCTTACCTACCGCGGAAATGCAAATGCAGTGCATCCAGACTATCCTG

Full Affymetrix probeset data:

Annotations for 1639774_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720