FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639775_at:

>probe:Drosophila_2:1639775_at:471:727; Interrogation_Position=109; Antisense; TTGGATGTGGTTGTGACTCCGACCC
>probe:Drosophila_2:1639775_at:714:411; Interrogation_Position=129; Antisense; GACCCTCTGACGTCTTGCAGATATT
>probe:Drosophila_2:1639775_at:118:693; Interrogation_Position=156; Antisense; TTTGAAATGCCTCCTGTTGAAGTGA
>probe:Drosophila_2:1639775_at:370:191; Interrogation_Position=252; Antisense; AACTTCAGCATATTCGTGGACTCGT
>probe:Drosophila_2:1639775_at:588:303; Interrogation_Position=281; Antisense; CCTGCAGGTCAATCACTCGGTGGTA
>probe:Drosophila_2:1639775_at:591:333; Interrogation_Position=311; Antisense; GCTGAGCTACCGGTTTGATTCCTAT
>probe:Drosophila_2:1639775_at:67:727; Interrogation_Position=325; Antisense; TTGATTCCTATATGGCGATGGCCGC
>probe:Drosophila_2:1639775_at:674:503; Interrogation_Position=372; Antisense; GTGTTTGCCCTTTCCAAGTGGAACG
>probe:Drosophila_2:1639775_at:157:307; Interrogation_Position=412; Antisense; CCTCCTCCAGGAAGCTAGTGATCAT
>probe:Drosophila_2:1639775_at:392:83; Interrogation_Position=494; Antisense; AGTGGTTCAGCAGGCGTTGATCCGC
>probe:Drosophila_2:1639775_at:258:449; Interrogation_Position=512; Antisense; GATCCGCTTCGATCAATGTCCGTAT
>probe:Drosophila_2:1639775_at:704:67; Interrogation_Position=561; Antisense; ATGGCCATGTCCTTTATCAAATCCT
>probe:Drosophila_2:1639775_at:235:501; Interrogation_Position=628; Antisense; GTCGGTCCCGACTTATATATCGTTT
>probe:Drosophila_2:1639775_at:92:217; Interrogation_Position=69; Antisense; AAGTTCGCAGTAGGTCCTGGCAGTC

Paste this into a BLAST search page for me
TTGGATGTGGTTGTGACTCCGACCCGACCCTCTGACGTCTTGCAGATATTTTTGAAATGCCTCCTGTTGAAGTGAAACTTCAGCATATTCGTGGACTCGTCCTGCAGGTCAATCACTCGGTGGTAGCTGAGCTACCGGTTTGATTCCTATTTGATTCCTATATGGCGATGGCCGCGTGTTTGCCCTTTCCAAGTGGAACGCCTCCTCCAGGAAGCTAGTGATCATAGTGGTTCAGCAGGCGTTGATCCGCGATCCGCTTCGATCAATGTCCGTATATGGCCATGTCCTTTATCAAATCCTGTCGGTCCCGACTTATATATCGTTTAAGTTCGCAGTAGGTCCTGGCAGTC

Full Affymetrix probeset data:

Annotations for 1639775_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720