FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639778_at:

>probe:Drosophila_2:1639778_at:58:89; Interrogation_Position=4930; Antisense; AGTCTGATTCGGAAGAGCCTCTCAC
>probe:Drosophila_2:1639778_at:551:95; Interrogation_Position=4974; Antisense; AGATCAGAATATTTGGCGCCAGGAC
>probe:Drosophila_2:1639778_at:652:515; Interrogation_Position=5008; Antisense; GTGTCCTCCATGCAATCCATAGACT
>probe:Drosophila_2:1639778_at:693:271; Interrogation_Position=5025; Antisense; CATAGACTCTGAGCTGGGTGGCCTG
>probe:Drosophila_2:1639778_at:304:463; Interrogation_Position=5080; Antisense; GATTCGCGGCTATCCGGTGGATCCA
>probe:Drosophila_2:1639778_at:485:519; Interrogation_Position=5096; Antisense; GTGGATCCACACAGAGCGACATACC
>probe:Drosophila_2:1639778_at:218:625; Interrogation_Position=5162; Antisense; TGCGCAGCCTGACCAAAAGCAGTCG
>probe:Drosophila_2:1639778_at:203:173; Interrogation_Position=5177; Antisense; AAAGCAGTCGCAATTCCGAGAGTGA
>probe:Drosophila_2:1639778_at:673:545; Interrogation_Position=5215; Antisense; GGATCTGACTCGGACATCAGCGTGG
>probe:Drosophila_2:1639778_at:228:35; Interrogation_Position=5230; Antisense; ATCAGCGTGGCCAGCGACATGAGAT
>probe:Drosophila_2:1639778_at:153:211; Interrogation_Position=5260; Antisense; AAGAAGGATCTTCGCGGCCGACTTT
>probe:Drosophila_2:1639778_at:148:401; Interrogation_Position=5279; Antisense; GACTTTCCGGCATGTTCAAGCGCTC
>probe:Drosophila_2:1639778_at:197:383; Interrogation_Position=5332; Antisense; GAACGTGCCGGTTCCGACCAGAGAC
>probe:Drosophila_2:1639778_at:175:523; Interrogation_Position=5359; Antisense; GTGGCCGTCACCGTAGTGGGACATC

Paste this into a BLAST search page for me
AGTCTGATTCGGAAGAGCCTCTCACAGATCAGAATATTTGGCGCCAGGACGTGTCCTCCATGCAATCCATAGACTCATAGACTCTGAGCTGGGTGGCCTGGATTCGCGGCTATCCGGTGGATCCAGTGGATCCACACAGAGCGACATACCTGCGCAGCCTGACCAAAAGCAGTCGAAAGCAGTCGCAATTCCGAGAGTGAGGATCTGACTCGGACATCAGCGTGGATCAGCGTGGCCAGCGACATGAGATAAGAAGGATCTTCGCGGCCGACTTTGACTTTCCGGCATGTTCAAGCGCTCGAACGTGCCGGTTCCGACCAGAGACGTGGCCGTCACCGTAGTGGGACATC

Full Affymetrix probeset data:

Annotations for 1639778_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720