FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639779_at:

>probe:Drosophila_2:1639779_at:277:625; Interrogation_Position=148; Antisense; TGCCCCAGGCGTTACCTTGTTAACA
>probe:Drosophila_2:1639779_at:294:709; Interrogation_Position=167; Antisense; TTAACAAGGATAACGCGCCTTGCGT
>probe:Drosophila_2:1639779_at:638:31; Interrogation_Position=176; Antisense; ATAACGCGCCTTGCGTGTGGTGTGC
>probe:Drosophila_2:1639779_at:259:723; Interrogation_Position=186; Antisense; TTGCGTGTGGTGTGCTCCGTGCAAA
>probe:Drosophila_2:1639779_at:306:591; Interrogation_Position=193; Antisense; TGGTGTGCTCCGTGCAAAGCCCACT
>probe:Drosophila_2:1639779_at:595:509; Interrogation_Position=204; Antisense; GTGCAAAGCCCACTGCTACAACACT
>probe:Drosophila_2:1639779_at:370:141; Interrogation_Position=215; Antisense; ACTGCTACAACACTCCGCCAAAATG
>probe:Drosophila_2:1639779_at:513:157; Interrogation_Position=224; Antisense; ACACTCCGCCAAAATGCTGTTGCTA
>probe:Drosophila_2:1639779_at:588:301; Interrogation_Position=229; Antisense; CCGCCAAAATGCTGTTGCTAGGTTT
>probe:Drosophila_2:1639779_at:60:335; Interrogation_Position=239; Antisense; GCTGTTGCTAGGTTTAGCCACCGAC
>probe:Drosophila_2:1639779_at:167:669; Interrogation_Position=251; Antisense; TTTAGCCACCGACTCTGGTCCTAAT
>probe:Drosophila_2:1639779_at:260:405; Interrogation_Position=261; Antisense; GACTCTGGTCCTAATCCTTTCCACT
>probe:Drosophila_2:1639779_at:286:233; Interrogation_Position=273; Antisense; AATCCTTTCCACTCCACACATTTGT
>probe:Drosophila_2:1639779_at:57:629; Interrogation_Position=285; Antisense; TCCACACATTTGTGGCTTCTAAGCG

Paste this into a BLAST search page for me
TGCCCCAGGCGTTACCTTGTTAACATTAACAAGGATAACGCGCCTTGCGTATAACGCGCCTTGCGTGTGGTGTGCTTGCGTGTGGTGTGCTCCGTGCAAATGGTGTGCTCCGTGCAAAGCCCACTGTGCAAAGCCCACTGCTACAACACTACTGCTACAACACTCCGCCAAAATGACACTCCGCCAAAATGCTGTTGCTACCGCCAAAATGCTGTTGCTAGGTTTGCTGTTGCTAGGTTTAGCCACCGACTTTAGCCACCGACTCTGGTCCTAATGACTCTGGTCCTAATCCTTTCCACTAATCCTTTCCACTCCACACATTTGTTCCACACATTTGTGGCTTCTAAGCG

Full Affymetrix probeset data:

Annotations for 1639779_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720