FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639781_at:

>probe:Drosophila_2:1639781_at:317:141; Interrogation_Position=212; Antisense; ACGGCAAGGAGGACGTTGACACTAC
>probe:Drosophila_2:1639781_at:16:409; Interrogation_Position=223; Antisense; GACGTTGACACTACGGAGTCGATCT
>probe:Drosophila_2:1639781_at:101:399; Interrogation_Position=229; Antisense; GACACTACGGAGTCGATCTACCTGT
>probe:Drosophila_2:1639781_at:353:147; Interrogation_Position=232; Antisense; ACTACGGAGTCGATCTACCTGTCCT
>probe:Drosophila_2:1639781_at:425:287; Interrogation_Position=236; Antisense; CGGAGTCGATCTACCTGTCCTCCTA
>probe:Drosophila_2:1639781_at:657:503; Interrogation_Position=252; Antisense; GTCCTCCTACTCCAATTACTATTAT
>probe:Drosophila_2:1639781_at:666:667; Interrogation_Position=268; Antisense; TACTATTATTTGACGGAGCAGCTCT
>probe:Drosophila_2:1639781_at:337:407; Interrogation_Position=279; Antisense; GACGGAGCAGCTCTATCCAAATACT
>probe:Drosophila_2:1639781_at:428:171; Interrogation_Position=28; Antisense; AAAGAGGACGCAGCCATGGCTGGCT
>probe:Drosophila_2:1639781_at:15:421; Interrogation_Position=283; Antisense; GAGCAGCTCTATCCAAATACTTATC
>probe:Drosophila_2:1639781_at:256:339; Interrogation_Position=288; Antisense; GCTCTATCCAAATACTTATCGCGTT
>probe:Drosophila_2:1639781_at:49:685; Interrogation_Position=292; Antisense; TATCCAAATACTTATCGCGTTCAGG
>probe:Drosophila_2:1639781_at:595:239; Interrogation_Position=298; Antisense; AATACTTATCGCGTTCAGGTCTCAG
>probe:Drosophila_2:1639781_at:253:669; Interrogation_Position=300; Antisense; TACTTATCGCGTTCAGGTCTCAGAG

Paste this into a BLAST search page for me
ACGGCAAGGAGGACGTTGACACTACGACGTTGACACTACGGAGTCGATCTGACACTACGGAGTCGATCTACCTGTACTACGGAGTCGATCTACCTGTCCTCGGAGTCGATCTACCTGTCCTCCTAGTCCTCCTACTCCAATTACTATTATTACTATTATTTGACGGAGCAGCTCTGACGGAGCAGCTCTATCCAAATACTAAAGAGGACGCAGCCATGGCTGGCTGAGCAGCTCTATCCAAATACTTATCGCTCTATCCAAATACTTATCGCGTTTATCCAAATACTTATCGCGTTCAGGAATACTTATCGCGTTCAGGTCTCAGTACTTATCGCGTTCAGGTCTCAGAG

Full Affymetrix probeset data:

Annotations for 1639781_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720