Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639782_at:

>probe:Drosophila_2:1639782_at:257:241; Interrogation_Position=1037; Antisense; AATAACGTTCGCTCTCAACGGCGGA
>probe:Drosophila_2:1639782_at:580:133; Interrogation_Position=499; Antisense; ACGCCTATTATAACGGCCAAATCGA
>probe:Drosophila_2:1639782_at:400:517; Interrogation_Position=562; Antisense; GTGTGTATGCTGTACGAATCTACCA
>probe:Drosophila_2:1639782_at:619:685; Interrogation_Position=607; Antisense; TATCTGCTAGAGCTGAGCACCCTGA
>probe:Drosophila_2:1639782_at:303:111; Interrogation_Position=622; Antisense; AGCACCCTGAGCTGGCAGTTTTTGG
>probe:Drosophila_2:1639782_at:3:257; Interrogation_Position=637; Antisense; CAGTTTTTGGCGGACACCTTTAGTG
>probe:Drosophila_2:1639782_at:144:85; Interrogation_Position=658; Antisense; AGTGAATACCTTCGGATGGCCATCG
>probe:Drosophila_2:1639782_at:248:69; Interrogation_Position=673; Antisense; ATGGCCATCGCGCACTTGGGACTGC
>probe:Drosophila_2:1639782_at:219:405; Interrogation_Position=692; Antisense; GACTGCCGTACTGGGAGCTGTGCTT
>probe:Drosophila_2:1639782_at:683:625; Interrogation_Position=731; Antisense; TGCCCTCTTGGACAGAGCAGCTGTT
>probe:Drosophila_2:1639782_at:672:113; Interrogation_Position=746; Antisense; AGCAGCTGTTTCTTTTGCTAGCACC
>probe:Drosophila_2:1639782_at:86:677; Interrogation_Position=764; Antisense; TAGCACCTCATCTTCTCGAGGAGCA
>probe:Drosophila_2:1639782_at:195:517; Interrogation_Position=800; Antisense; GTGGACGAGTACTGAATCCCGCTTG
>probe:Drosophila_2:1639782_at:265:623; Interrogation_Position=823; Antisense; TGCGAGCATCCGTACAATATCATTG

Paste this into a BLAST search page for me
AATAACGTTCGCTCTCAACGGCGGAACGCCTATTATAACGGCCAAATCGAGTGTGTATGCTGTACGAATCTACCATATCTGCTAGAGCTGAGCACCCTGAAGCACCCTGAGCTGGCAGTTTTTGGCAGTTTTTGGCGGACACCTTTAGTGAGTGAATACCTTCGGATGGCCATCGATGGCCATCGCGCACTTGGGACTGCGACTGCCGTACTGGGAGCTGTGCTTTGCCCTCTTGGACAGAGCAGCTGTTAGCAGCTGTTTCTTTTGCTAGCACCTAGCACCTCATCTTCTCGAGGAGCAGTGGACGAGTACTGAATCCCGCTTGTGCGAGCATCCGTACAATATCATTG

Full Affymetrix probeset data:

Annotations for 1639782_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime