FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639784_at:

>probe:Drosophila_2:1639784_at:520:127; Interrogation_Position=1010; Antisense; ACCAATCGCATTGACATCCTGGATC
>probe:Drosophila_2:1639784_at:301:503; Interrogation_Position=1047; Antisense; GTCCCGGCCGTATTGATCGCAAGAT
>probe:Drosophila_2:1639784_at:390:439; Interrogation_Position=1094; Antisense; GAGGCGCGTCTGGACATCTTGAAGA
>probe:Drosophila_2:1639784_at:726:723; Interrogation_Position=1112; Antisense; TTGAAGATCCACTCCCGTAAGATGA
>probe:Drosophila_2:1639784_at:426:489; Interrogation_Position=1128; Antisense; GTAAGATGAACCTCACGCGTGGCAT
>probe:Drosophila_2:1639784_at:490:655; Interrogation_Position=1153; Antisense; TAATCTGCGCAAGATCGCCGAGCTA
>probe:Drosophila_2:1639784_at:84:75; Interrogation_Position=1269; Antisense; AGGACTTCGAGATGGCTGTGGCCAA
>probe:Drosophila_2:1639784_at:507:485; Interrogation_Position=1345; Antisense; GTAGGCGTTGATCGGCCATTGCAAA
>probe:Drosophila_2:1639784_at:130:423; Interrogation_Position=822; Antisense; GAGAACTCTTTGTAATGGCCCGGGA
>probe:Drosophila_2:1639784_at:480:301; Interrogation_Position=840; Antisense; CCCGGGAACATGCACCATCAATTAT
>probe:Drosophila_2:1639784_at:677:393; Interrogation_Position=875; Antisense; GAAATCGATTCCATTGGCTCGTCGC
>probe:Drosophila_2:1639784_at:298:569; Interrogation_Position=890; Antisense; GGCTCGTCGCGTATTGAGTCAGGTT
>probe:Drosophila_2:1639784_at:552:327; Interrogation_Position=921; Antisense; GCGATTCCGAGGTGCAGCGTACTAT
>probe:Drosophila_2:1639784_at:286:557; Interrogation_Position=967; Antisense; GGACGGCTTTGAGGCCACCAAGAAC

Paste this into a BLAST search page for me
ACCAATCGCATTGACATCCTGGATCGTCCCGGCCGTATTGATCGCAAGATGAGGCGCGTCTGGACATCTTGAAGATTGAAGATCCACTCCCGTAAGATGAGTAAGATGAACCTCACGCGTGGCATTAATCTGCGCAAGATCGCCGAGCTAAGGACTTCGAGATGGCTGTGGCCAAGTAGGCGTTGATCGGCCATTGCAAAGAGAACTCTTTGTAATGGCCCGGGACCCGGGAACATGCACCATCAATTATGAAATCGATTCCATTGGCTCGTCGCGGCTCGTCGCGTATTGAGTCAGGTTGCGATTCCGAGGTGCAGCGTACTATGGACGGCTTTGAGGCCACCAAGAAC

Full Affymetrix probeset data:

Annotations for 1639784_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720