FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639787_at:

>probe:Drosophila_2:1639787_at:322:723; Interrogation_Position=3651; Antisense; TTGCACATGACAAAGCACCACTGCT
>probe:Drosophila_2:1639787_at:645:55; Interrogation_Position=3657; Antisense; ATGACAAAGCACCACTGCTTCGACT
>probe:Drosophila_2:1639787_at:539:113; Interrogation_Position=3664; Antisense; AGCACCACTGCTTCGACTAATAAGA
>probe:Drosophila_2:1639787_at:721:127; Interrogation_Position=3667; Antisense; ACCACTGCTTCGACTAATAAGAAAT
>probe:Drosophila_2:1639787_at:144:295; Interrogation_Position=3677; Antisense; CGACTAATAAGAAATTGGTCTCGAA
>probe:Drosophila_2:1639787_at:217:3; Interrogation_Position=3690; Antisense; ATTGGTCTCGAAAAAGTTGGTCTAT
>probe:Drosophila_2:1639787_at:348:497; Interrogation_Position=3694; Antisense; GTCTCGAAAAAGTTGGTCTATGCAC
>probe:Drosophila_2:1639787_at:402:183; Interrogation_Position=3701; Antisense; AAAAGTTGGTCTATGCACGTGAGCG
>probe:Drosophila_2:1639787_at:217:95; Interrogation_Position=3704; Antisense; AGTTGGTCTATGCACGTGAGCGTTT
>probe:Drosophila_2:1639787_at:670:729; Interrogation_Position=3706; Antisense; TTGGTCTATGCACGTGAGCGTTTAT
>probe:Drosophila_2:1639787_at:288:643; Interrogation_Position=3710; Antisense; TCTATGCACGTGAGCGTTTATGCGC
>probe:Drosophila_2:1639787_at:270:355; Interrogation_Position=3715; Antisense; GCACGTGAGCGTTTATGCGCTGTTT
>probe:Drosophila_2:1639787_at:691:327; Interrogation_Position=3723; Antisense; GCGTTTATGCGCTGTTTGATTAATG
>probe:Drosophila_2:1639787_at:225:683; Interrogation_Position=3728; Antisense; TATGCGCTGTTTGATTAATGTTAAT

Paste this into a BLAST search page for me
TTGCACATGACAAAGCACCACTGCTATGACAAAGCACCACTGCTTCGACTAGCACCACTGCTTCGACTAATAAGAACCACTGCTTCGACTAATAAGAAATCGACTAATAAGAAATTGGTCTCGAAATTGGTCTCGAAAAAGTTGGTCTATGTCTCGAAAAAGTTGGTCTATGCACAAAAGTTGGTCTATGCACGTGAGCGAGTTGGTCTATGCACGTGAGCGTTTTTGGTCTATGCACGTGAGCGTTTATTCTATGCACGTGAGCGTTTATGCGCGCACGTGAGCGTTTATGCGCTGTTTGCGTTTATGCGCTGTTTGATTAATGTATGCGCTGTTTGATTAATGTTAAT

Full Affymetrix probeset data:

Annotations for 1639787_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720