FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639788_at:

>probe:Drosophila_2:1639788_at:467:169; Interrogation_Position=109; Antisense; AAATGGCTCTGCACTCGGCAATCAA
>probe:Drosophila_2:1639788_at:610:195; Interrogation_Position=139; Antisense; AACTGATCAGCGTTATCGGCGACGA
>probe:Drosophila_2:1639788_at:682:367; Interrogation_Position=212; Antisense; GAATCGCCATCCCAACTTTATGGTG
>probe:Drosophila_2:1639788_at:314:143; Interrogation_Position=263; Antisense; ACTGGAGGACTGTTTCAAGCGTTTC
>probe:Drosophila_2:1639788_at:551:251; Interrogation_Position=278; Antisense; CAAGCGTTTCCTTAAGCGGGACGAT
>probe:Drosophila_2:1639788_at:140:625; Interrogation_Position=330; Antisense; TGCGCCGAGCTTATTCGTCATGTGA
>probe:Drosophila_2:1639788_at:694:505; Interrogation_Position=375; Antisense; GTGCCCGCTGTTTTGGAGATTCCCT
>probe:Drosophila_2:1639788_at:227:489; Interrogation_Position=413; Antisense; GTACGACGCCAGCAAGGACTCCATT
>probe:Drosophila_2:1639788_at:53:453; Interrogation_Position=471; Antisense; GATCTGGTGCGCTAATTCCTCGAAT
>probe:Drosophila_2:1639788_at:546:363; Interrogation_Position=492; Antisense; GAATTCTGCTCGAGGACACTGTTTC
>probe:Drosophila_2:1639788_at:256:397; Interrogation_Position=506; Antisense; GACACTGTTTCGTATTGCTGCAACC
>probe:Drosophila_2:1639788_at:253:313; Interrogation_Position=531; Antisense; GCCAGAGAATTGCTTTACACCCTGT
>probe:Drosophila_2:1639788_at:589:47; Interrogation_Position=564; Antisense; ATCCATAGATTCAGTGCTTCGCCTT
>probe:Drosophila_2:1639788_at:205:343; Interrogation_Position=579; Antisense; GCTTCGCCTTTGTTCTTATCGTGTA

Paste this into a BLAST search page for me
AAATGGCTCTGCACTCGGCAATCAAAACTGATCAGCGTTATCGGCGACGAGAATCGCCATCCCAACTTTATGGTGACTGGAGGACTGTTTCAAGCGTTTCCAAGCGTTTCCTTAAGCGGGACGATTGCGCCGAGCTTATTCGTCATGTGAGTGCCCGCTGTTTTGGAGATTCCCTGTACGACGCCAGCAAGGACTCCATTGATCTGGTGCGCTAATTCCTCGAATGAATTCTGCTCGAGGACACTGTTTCGACACTGTTTCGTATTGCTGCAACCGCCAGAGAATTGCTTTACACCCTGTATCCATAGATTCAGTGCTTCGCCTTGCTTCGCCTTTGTTCTTATCGTGTA

Full Affymetrix probeset data:

Annotations for 1639788_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720