Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639789_at:

>probe:Drosophila_2:1639789_at:232:265; Interrogation_Position=1763; Antisense; CGGAGGACTACAAGCCCCAGGAGGA
>probe:Drosophila_2:1639789_at:314:109; Interrogation_Position=1814; Antisense; AGAAGAAGAGCAAGCGGGCCACCGA
>probe:Drosophila_2:1639789_at:85:331; Interrogation_Position=1827; Antisense; GCGGGCCACCGAAATCAATCAGGAA
>probe:Drosophila_2:1639789_at:394:109; Interrogation_Position=1881; Antisense; AGCGGCGGCTCATCCTTCGGAGGCT
>probe:Drosophila_2:1639789_at:566:501; Interrogation_Position=1915; Antisense; GTCGAAGCAGAAGCTCACGCCGCAG
>probe:Drosophila_2:1639789_at:329:625; Interrogation_Position=1950; Antisense; TGCCGTGGAAGGAGATGCCGCACCA
>probe:Drosophila_2:1639789_at:400:129; Interrogation_Position=2025; Antisense; ACCAGCTGAGCCAGCCGCCGAAGGA
>probe:Drosophila_2:1639789_at:421:77; Interrogation_Position=2114; Antisense; AGGAGGCGCCACATGAGGCGCCCAA
>probe:Drosophila_2:1639789_at:520:251; Interrogation_Position=2136; Antisense; CAAGGAGGAGGCACCTGCCGCCGAA
>probe:Drosophila_2:1639789_at:701:201; Interrogation_Position=2171; Antisense; AACCGGAGGCAGAAGCTCCTGCTCC
>probe:Drosophila_2:1639789_at:265:415; Interrogation_Position=2218; Antisense; GAGCCAGCAGCCGAGTAAACCAGTA
>probe:Drosophila_2:1639789_at:595:491; Interrogation_Position=2232; Antisense; GTAAACCAGTATAGCACTCATTATT
>probe:Drosophila_2:1639789_at:666:355; Interrogation_Position=2245; Antisense; GCACTCATTATTACTCATTATTTGG
>probe:Drosophila_2:1639789_at:487:481; Interrogation_Position=2287; Antisense; GTATACGCGAAAATTCCCAGTTGTT

Paste this into a BLAST search page for me
CGGAGGACTACAAGCCCCAGGAGGAAGAAGAAGAGCAAGCGGGCCACCGAGCGGGCCACCGAAATCAATCAGGAAAGCGGCGGCTCATCCTTCGGAGGCTGTCGAAGCAGAAGCTCACGCCGCAGTGCCGTGGAAGGAGATGCCGCACCAACCAGCTGAGCCAGCCGCCGAAGGAAGGAGGCGCCACATGAGGCGCCCAACAAGGAGGAGGCACCTGCCGCCGAAAACCGGAGGCAGAAGCTCCTGCTCCGAGCCAGCAGCCGAGTAAACCAGTAGTAAACCAGTATAGCACTCATTATTGCACTCATTATTACTCATTATTTGGGTATACGCGAAAATTCCCAGTTGTT

Full Affymetrix probeset data:

Annotations for 1639789_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime