FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639790_at:

>probe:Drosophila_2:1639790_at:324:703; Interrogation_Position=457; Antisense; TTATTTGATCGTCAACTGGCTGCCC
>probe:Drosophila_2:1639790_at:206:299; Interrogation_Position=481; Antisense; CGCTCAGTCGATTGTTCTGTGGCAA
>probe:Drosophila_2:1639790_at:178:101; Interrogation_Position=519; Antisense; AGAGTGCTCCGCTTTGGTGGACCTT
>probe:Drosophila_2:1639790_at:7:587; Interrogation_Position=536; Antisense; TGGACCTTCGTGATCACCCATGGCA
>probe:Drosophila_2:1639790_at:483:269; Interrogation_Position=554; Antisense; CATGGCATCTGCTGGGTTGTCATCT
>probe:Drosophila_2:1639790_at:70:543; Interrogation_Position=568; Antisense; GGTTGTCATCTTTGGCGGCAGTTTG
>probe:Drosophila_2:1639790_at:81:593; Interrogation_Position=591; Antisense; TGGTGATGGATCTGCCAGAGCTGCT
>probe:Drosophila_2:1639790_at:691:621; Interrogation_Position=612; Antisense; TGCTGGGCGTCAAGCAAGCCTACTA
>probe:Drosophila_2:1639790_at:39:669; Interrogation_Position=632; Antisense; TACTACGATCTGAAGGCCTACGGAC
>probe:Drosophila_2:1639790_at:375:565; Interrogation_Position=679; Antisense; GGAATTGCGCAATCTGTACGCCCAT
>probe:Drosophila_2:1639790_at:164:269; Interrogation_Position=701; Antisense; CATGTCAGACATCCCTCGTTTGTGG
>probe:Drosophila_2:1639790_at:571:47; Interrogation_Position=737; Antisense; ATCCTGTTCGCCACGAATGTGATGA
>probe:Drosophila_2:1639790_at:528:589; Interrogation_Position=765; Antisense; TGGATCGGCTAGTCATGGCCTTGCT
>probe:Drosophila_2:1639790_at:282:287; Interrogation_Position=809; Antisense; CTGGCCTGGTCCACAGATCAGAAGG

Paste this into a BLAST search page for me
TTATTTGATCGTCAACTGGCTGCCCCGCTCAGTCGATTGTTCTGTGGCAAAGAGTGCTCCGCTTTGGTGGACCTTTGGACCTTCGTGATCACCCATGGCACATGGCATCTGCTGGGTTGTCATCTGGTTGTCATCTTTGGCGGCAGTTTGTGGTGATGGATCTGCCAGAGCTGCTTGCTGGGCGTCAAGCAAGCCTACTATACTACGATCTGAAGGCCTACGGACGGAATTGCGCAATCTGTACGCCCATCATGTCAGACATCCCTCGTTTGTGGATCCTGTTCGCCACGAATGTGATGATGGATCGGCTAGTCATGGCCTTGCTCTGGCCTGGTCCACAGATCAGAAGG

Full Affymetrix probeset data:

Annotations for 1639790_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720