Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639792_at:

>probe:Drosophila_2:1639792_at:433:533; Interrogation_Position=3711; Antisense; GGTGTCCAATGAGTCGAGATCCAGC
>probe:Drosophila_2:1639792_at:404:165; Interrogation_Position=3793; Antisense; AAATCCACGAATCTGGGACCTGCCA
>probe:Drosophila_2:1639792_at:280:593; Interrogation_Position=3806; Antisense; TGGGACCTGCCATATCTATTACTGG
>probe:Drosophila_2:1639792_at:226:101; Interrogation_Position=3832; Antisense; AGAGTGGACTTACGGCTGCCCAAGA
>probe:Drosophila_2:1639792_at:315:343; Interrogation_Position=3860; Antisense; GCTTCTCTGGCTACCTAAATGTTCA
>probe:Drosophila_2:1639792_at:502:471; Interrogation_Position=3880; Antisense; GTTCAGGATCCGAAGAGCCAACACA
>probe:Drosophila_2:1639792_at:148:327; Interrogation_Position=3935; Antisense; GCGTTCGGTTATCGGTTTGGCAACA
>probe:Drosophila_2:1639792_at:428:605; Interrogation_Position=3978; Antisense; TGATATCCCGATTTTCACGCTGGAG
>probe:Drosophila_2:1639792_at:333:557; Interrogation_Position=4009; Antisense; GGACTCGGACAATCCCTGATAGCTG
>probe:Drosophila_2:1639792_at:527:499; Interrogation_Position=4052; Antisense; GTGCTCGGGCGAGAAGTTTTCTGCT
>probe:Drosophila_2:1639792_at:262:551; Interrogation_Position=4106; Antisense; GGAGAGTCTTCTTTGCTGCCGATAC
>probe:Drosophila_2:1639792_at:109:457; Interrogation_Position=4126; Antisense; GATACGCAAGCGGAGCTCTCGGAAT
>probe:Drosophila_2:1639792_at:230:167; Interrogation_Position=4164; Antisense; AAATGAGGCTATCGCATTCGCCAGG
>probe:Drosophila_2:1639792_at:251:725; Interrogation_Position=4206; Antisense; TTGACAGCTCGTGCATTGCCAAACA

Paste this into a BLAST search page for me
GGTGTCCAATGAGTCGAGATCCAGCAAATCCACGAATCTGGGACCTGCCATGGGACCTGCCATATCTATTACTGGAGAGTGGACTTACGGCTGCCCAAGAGCTTCTCTGGCTACCTAAATGTTCAGTTCAGGATCCGAAGAGCCAACACAGCGTTCGGTTATCGGTTTGGCAACATGATATCCCGATTTTCACGCTGGAGGGACTCGGACAATCCCTGATAGCTGGTGCTCGGGCGAGAAGTTTTCTGCTGGAGAGTCTTCTTTGCTGCCGATACGATACGCAAGCGGAGCTCTCGGAATAAATGAGGCTATCGCATTCGCCAGGTTGACAGCTCGTGCATTGCCAAACA

Full Affymetrix probeset data:

Annotations for 1639792_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime