Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639794_at:

>probe:Drosophila_2:1639794_at:719:679; Interrogation_Position=123; Antisense; TATCCGTCGAGATAGTTGATCCCGA
>probe:Drosophila_2:1639794_at:233:569; Interrogation_Position=151; Antisense; GGCTAAATCCCTGCACGATAATGGT
>probe:Drosophila_2:1639794_at:564:237; Interrogation_Position=195; Antisense; AATCTCGCGGAGGACCAGCAAGTGG
>probe:Drosophila_2:1639794_at:7:389; Interrogation_Position=230; Antisense; GAAACCCTGTTTCTCGGAATGGAAG
>probe:Drosophila_2:1639794_at:642:339; Interrogation_Position=261; Antisense; GCTTCCTGGCCCACTATTTAAATGT
>probe:Drosophila_2:1639794_at:622:715; Interrogation_Position=323; Antisense; TTCTGCATGTTTGTGGAGGTCGCCA
>probe:Drosophila_2:1639794_at:602:421; Interrogation_Position=371; Antisense; GAGAACTTGGCCAGCTATGTGTATT
>probe:Drosophila_2:1639794_at:658:471; Interrogation_Position=433; Antisense; GTTCGGCGGTGATTTTCTTATCTAC
>probe:Drosophila_2:1639794_at:497:171; Interrogation_Position=462; Antisense; AAAGTCCTCGATTGTACCATGCCAG
>probe:Drosophila_2:1639794_at:650:313; Interrogation_Position=482; Antisense; GCCAGCTTTTTGGTCATTGTGCAAA
>probe:Drosophila_2:1639794_at:287:513; Interrogation_Position=549; Antisense; GTGTTCAACGCGTGGCAGAAACTTC
>probe:Drosophila_2:1639794_at:661:31; Interrogation_Position=576; Antisense; ATAAGGATGTGCTGCTCCTGACTGT
>probe:Drosophila_2:1639794_at:265:285; Interrogation_Position=593; Antisense; CTGACTGTCCAACCGCCTAAGAAGA
>probe:Drosophila_2:1639794_at:237:659; Interrogation_Position=618; Antisense; TAAGCTCTTCCAGGGATTTGCAGGA

Paste this into a BLAST search page for me
TATCCGTCGAGATAGTTGATCCCGAGGCTAAATCCCTGCACGATAATGGTAATCTCGCGGAGGACCAGCAAGTGGGAAACCCTGTTTCTCGGAATGGAAGGCTTCCTGGCCCACTATTTAAATGTTTCTGCATGTTTGTGGAGGTCGCCAGAGAACTTGGCCAGCTATGTGTATTGTTCGGCGGTGATTTTCTTATCTACAAAGTCCTCGATTGTACCATGCCAGGCCAGCTTTTTGGTCATTGTGCAAAGTGTTCAACGCGTGGCAGAAACTTCATAAGGATGTGCTGCTCCTGACTGTCTGACTGTCCAACCGCCTAAGAAGATAAGCTCTTCCAGGGATTTGCAGGA

Full Affymetrix probeset data:

Annotations for 1639794_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime