FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639795_at:

>probe:Drosophila_2:1639795_at:453:465; Interrogation_Position=1554; Antisense; GTTGTACTGGAAACCGATCTCTGCG
>probe:Drosophila_2:1639795_at:646:389; Interrogation_Position=1594; Antisense; GAAACGCTGTCCATCAGCCTAATTG
>probe:Drosophila_2:1639795_at:77:453; Interrogation_Position=1619; Antisense; GATCTTACTGCTAGAGGATGCCTAT
>probe:Drosophila_2:1639795_at:636:687; Interrogation_Position=1641; Antisense; TATTCAGATGGCAGTCCACGTTTCC
>probe:Drosophila_2:1639795_at:385:685; Interrogation_Position=1714; Antisense; TATACACACACGACAACCAGGACTT
>probe:Drosophila_2:1639795_at:490:15; Interrogation_Position=1755; Antisense; ATTTTACGAATTTTGCCGCTCCATT
>probe:Drosophila_2:1639795_at:179:379; Interrogation_Position=1822; Antisense; GAAGCTGCCTTCGTTTTCAATTTAC
>probe:Drosophila_2:1639795_at:235:247; Interrogation_Position=1869; Antisense; AATTCGTCGCCCATTGTAATCCTCA
>probe:Drosophila_2:1639795_at:526:493; Interrogation_Position=1884; Antisense; GTAATCCTCAAGTCCTAGATCGTAA
>probe:Drosophila_2:1639795_at:714:91; Interrogation_Position=1927; Antisense; AGTTAACAGTTAGCTCCTGGCAGCC
>probe:Drosophila_2:1639795_at:625:713; Interrogation_Position=1956; Antisense; TTCATCCTTGTGTTCGTCGTTCTAA
>probe:Drosophila_2:1639795_at:120:181; Interrogation_Position=1994; Antisense; AAAACTCTCGACTCTACGTTCTGTT
>probe:Drosophila_2:1639795_at:127:473; Interrogation_Position=2011; Antisense; GTTCTGTTCACACCAACTAGCGTAG
>probe:Drosophila_2:1639795_at:679:23; Interrogation_Position=2058; Antisense; ATATCCATTGCCAGACTTGAGTTTG

Paste this into a BLAST search page for me
GTTGTACTGGAAACCGATCTCTGCGGAAACGCTGTCCATCAGCCTAATTGGATCTTACTGCTAGAGGATGCCTATTATTCAGATGGCAGTCCACGTTTCCTATACACACACGACAACCAGGACTTATTTTACGAATTTTGCCGCTCCATTGAAGCTGCCTTCGTTTTCAATTTACAATTCGTCGCCCATTGTAATCCTCAGTAATCCTCAAGTCCTAGATCGTAAAGTTAACAGTTAGCTCCTGGCAGCCTTCATCCTTGTGTTCGTCGTTCTAAAAAACTCTCGACTCTACGTTCTGTTGTTCTGTTCACACCAACTAGCGTAGATATCCATTGCCAGACTTGAGTTTG

Full Affymetrix probeset data:

Annotations for 1639795_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720