FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639797_at:

>probe:Drosophila_2:1639797_at:425:445; Interrogation_Position=120; Antisense; GATGAACGCGACTAGTGCATACCCC
>probe:Drosophila_2:1639797_at:261:53; Interrogation_Position=13; Antisense; ATGCTCTTCTTCTTTTTTGCGCCTG
>probe:Drosophila_2:1639797_at:27:39; Interrogation_Position=161; Antisense; ATCTGCCCACCGAGTTCCTGATCAA
>probe:Drosophila_2:1639797_at:452:605; Interrogation_Position=179; Antisense; TGATCAACGGCATCGTGTCCGCCTG
>probe:Drosophila_2:1639797_at:262:283; Interrogation_Position=201; Antisense; CTGCCTGACCATCGTGAATGTCATT
>probe:Drosophila_2:1639797_at:406:497; Interrogation_Position=220; Antisense; GTCATTTGCATATTTATCACGGCCA
>probe:Drosophila_2:1639797_at:163:699; Interrogation_Position=233; Antisense; TTATCACGGCCATAATCGTATTGAA
>probe:Drosophila_2:1639797_at:14:13; Interrogation_Position=259; Antisense; ATTAAAGAGGTCTCGGCGCCATATA
>probe:Drosophila_2:1639797_at:173:315; Interrogation_Position=276; Antisense; GCCATATACGGCCAGTCCGGATTTA
>probe:Drosophila_2:1639797_at:730:511; Interrogation_Position=37; Antisense; GTGTTGCAGGGTCTCTTCTGGTCAC
>probe:Drosophila_2:1639797_at:347:591; Interrogation_Position=55; Antisense; TGGTCACTGGCCTGCATTTGGCTCA
>probe:Drosophila_2:1639797_at:528:345; Interrogation_Position=68; Antisense; GCATTTGGCTCATCTATCCGGAGAA
>probe:Drosophila_2:1639797_at:547:631; Interrogation_Position=84; Antisense; TCCGGAGAAGCGGATTCCGCACTTG
>probe:Drosophila_2:1639797_at:297:631; Interrogation_Position=99; Antisense; TCCGCACTTGAAGAACGAGGCGATG

Paste this into a BLAST search page for me
GATGAACGCGACTAGTGCATACCCCATGCTCTTCTTCTTTTTTGCGCCTGATCTGCCCACCGAGTTCCTGATCAATGATCAACGGCATCGTGTCCGCCTGCTGCCTGACCATCGTGAATGTCATTGTCATTTGCATATTTATCACGGCCATTATCACGGCCATAATCGTATTGAAATTAAAGAGGTCTCGGCGCCATATAGCCATATACGGCCAGTCCGGATTTAGTGTTGCAGGGTCTCTTCTGGTCACTGGTCACTGGCCTGCATTTGGCTCAGCATTTGGCTCATCTATCCGGAGAATCCGGAGAAGCGGATTCCGCACTTGTCCGCACTTGAAGAACGAGGCGATG

Full Affymetrix probeset data:

Annotations for 1639797_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720