Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639798_at:

>probe:Drosophila_2:1639798_at:695:617; Interrogation_Position=3128; Antisense; TGCATACCCGACCACTAACATATAA
>probe:Drosophila_2:1639798_at:424:251; Interrogation_Position=3192; Antisense; CAAGTGGCACGTGGCAACTGGCAGA
>probe:Drosophila_2:1639798_at:415:567; Interrogation_Position=3211; Antisense; GGCAGATCCGAAACACCCACTAAAT
>probe:Drosophila_2:1639798_at:220:675; Interrogation_Position=3238; Antisense; TAGAAGCACACATCCTGGCAGCTAG
>probe:Drosophila_2:1639798_at:142:681; Interrogation_Position=3260; Antisense; TAGGTCCACTTCTATCCGGTAGATT
>probe:Drosophila_2:1639798_at:105:133; Interrogation_Position=3337; Antisense; ACCCCTTCAAGGTCCTGTGGCAGGA
>probe:Drosophila_2:1639798_at:474:107; Interrogation_Position=3368; Antisense; AGAACATATCAACCCAAGTCTGCTG
>probe:Drosophila_2:1639798_at:507:707; Interrogation_Position=3426; Antisense; TTAACCTTAACCAATCCTCTTCATT
>probe:Drosophila_2:1639798_at:345:645; Interrogation_Position=3443; Antisense; TCTTCATTTCCCAATCGAGCGAGCC
>probe:Drosophila_2:1639798_at:516:177; Interrogation_Position=3470; Antisense; AACACCCAAGCCAAATGTACACGAG
>probe:Drosophila_2:1639798_at:593:119; Interrogation_Position=3508; Antisense; AGCTGTTATTGTTTTTATCGTCTTA
>probe:Drosophila_2:1639798_at:287:671; Interrogation_Position=3536; Antisense; TACCAATTTGTTCCTGTCGTTTATA
>probe:Drosophila_2:1639798_at:413:427; Interrogation_Position=3625; Antisense; GAGATCCATGTATTGCTGTACTTTA
>probe:Drosophila_2:1639798_at:504:725; Interrogation_Position=3658; Antisense; TTGTAAGTATGTAAGCTCGCGTAAT

Paste this into a BLAST search page for me
TGCATACCCGACCACTAACATATAACAAGTGGCACGTGGCAACTGGCAGAGGCAGATCCGAAACACCCACTAAATTAGAAGCACACATCCTGGCAGCTAGTAGGTCCACTTCTATCCGGTAGATTACCCCTTCAAGGTCCTGTGGCAGGAAGAACATATCAACCCAAGTCTGCTGTTAACCTTAACCAATCCTCTTCATTTCTTCATTTCCCAATCGAGCGAGCCAACACCCAAGCCAAATGTACACGAGAGCTGTTATTGTTTTTATCGTCTTATACCAATTTGTTCCTGTCGTTTATAGAGATCCATGTATTGCTGTACTTTATTGTAAGTATGTAAGCTCGCGTAAT

Full Affymetrix probeset data:

Annotations for 1639798_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime