Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639799_s_at:

>probe:Drosophila_2:1639799_s_at:671:477; Interrogation_Position=100; Antisense; GTTTCATCGGTCACTATTCCATCGG
>probe:Drosophila_2:1639799_s_at:27:539; Interrogation_Position=108; Antisense; GGTCACTATTCCATCGGTCACTATT
>probe:Drosophila_2:1639799_s_at:259:7; Interrogation_Position=115; Antisense; ATTCCATCGGTCACTATTCCTTCGG
>probe:Drosophila_2:1639799_s_at:26:539; Interrogation_Position=123; Antisense; GGTCACTATTCCTTCGGTCACTATT
>probe:Drosophila_2:1639799_s_at:268:9; Interrogation_Position=130; Antisense; ATTCCTTCGGTCACTATTCCGACCA
>probe:Drosophila_2:1639799_s_at:550:689; Interrogation_Position=144; Antisense; TATTCCGACCACTGATACAGACACG
>probe:Drosophila_2:1639799_s_at:36:143; Interrogation_Position=154; Antisense; ACTGATACAGACACGTCCACCACTT
>probe:Drosophila_2:1639799_s_at:15:279; Interrogation_Position=242; Antisense; CTACCGTTGTCCACTACAAGAAGAA
>probe:Drosophila_2:1639799_s_at:32:193; Interrogation_Position=27; Antisense; AACTATCTTCCTTGCCATCGCGGCT
>probe:Drosophila_2:1639799_s_at:142:377; Interrogation_Position=321; Antisense; GAAGAACCGATCGAGTTGGGAATAA
>probe:Drosophila_2:1639799_s_at:3:723; Interrogation_Position=38; Antisense; TTGCCATCGCGGCTTTCGTTTCGAC
>probe:Drosophila_2:1639799_s_at:423:715; Interrogation_Position=52; Antisense; TTCGTTTCGACTGCCTGGGCACTGA
>probe:Drosophila_2:1639799_s_at:570:311; Interrogation_Position=88; Antisense; GCCACGGTCACTGTTTCATCGGTCA
>probe:Drosophila_2:1639799_s_at:28:539; Interrogation_Position=93; Antisense; GGTCACTGTTTCATCGGTCACTATT

Paste this into a BLAST search page for me
GTTTCATCGGTCACTATTCCATCGGGGTCACTATTCCATCGGTCACTATTATTCCATCGGTCACTATTCCTTCGGGGTCACTATTCCTTCGGTCACTATTATTCCTTCGGTCACTATTCCGACCATATTCCGACCACTGATACAGACACGACTGATACAGACACGTCCACCACTTCTACCGTTGTCCACTACAAGAAGAAAACTATCTTCCTTGCCATCGCGGCTGAAGAACCGATCGAGTTGGGAATAATTGCCATCGCGGCTTTCGTTTCGACTTCGTTTCGACTGCCTGGGCACTGAGCCACGGTCACTGTTTCATCGGTCAGGTCACTGTTTCATCGGTCACTATT

Full Affymetrix probeset data:

Annotations for 1639799_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime