FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639801_at:

>probe:Drosophila_2:1639801_at:291:545; Interrogation_Position=1037; Antisense; GGATCATCCTAGTTGCTCCAAACAA
>probe:Drosophila_2:1639801_at:102:617; Interrogation_Position=1072; Antisense; TGCAATATCGACTGGTGCCCTTCGA
>probe:Drosophila_2:1639801_at:516:181; Interrogation_Position=1118; Antisense; AAAACGCGTGCGATTGTACCTTATC
>probe:Drosophila_2:1639801_at:353:485; Interrogation_Position=1133; Antisense; GTACCTTATCGATCTGGATTCGGCA
>probe:Drosophila_2:1639801_at:352:371; Interrogation_Position=1217; Antisense; GAAGGACGTCATCAAGTTCGGATTT
>probe:Drosophila_2:1639801_at:726:471; Interrogation_Position=1232; Antisense; GTTCGGATTTAGTTCGCGCGAGTAT
>probe:Drosophila_2:1639801_at:377:327; Interrogation_Position=1249; Antisense; GCGAGTATGTTCTGCTCCACGAAAA
>probe:Drosophila_2:1639801_at:229:225; Interrogation_Position=1311; Antisense; AAGGATGAGCCGCACGATGCACCAA
>probe:Drosophila_2:1639801_at:366:373; Interrogation_Position=1338; Antisense; GAAGTGGCAAATCCCTAGATGACAT
>probe:Drosophila_2:1639801_at:386:165; Interrogation_Position=1453; Antisense; AAATCTGCTACGGAACACGGCCAAC
>probe:Drosophila_2:1639801_at:405:573; Interrogation_Position=925; Antisense; GGCGCTGGAGATTGTACCCGTTCAA
>probe:Drosophila_2:1639801_at:167:489; Interrogation_Position=938; Antisense; GTACCCGTTCAAGGGCGAAACAGCA
>probe:Drosophila_2:1639801_at:148:261; Interrogation_Position=968; Antisense; CACGCTCCATATTCATCGGCAGAGT
>probe:Drosophila_2:1639801_at:221:101; Interrogation_Position=988; Antisense; AGAGTTGCTTTCTGGTTGGACGCGA

Paste this into a BLAST search page for me
GGATCATCCTAGTTGCTCCAAACAATGCAATATCGACTGGTGCCCTTCGAAAAACGCGTGCGATTGTACCTTATCGTACCTTATCGATCTGGATTCGGCAGAAGGACGTCATCAAGTTCGGATTTGTTCGGATTTAGTTCGCGCGAGTATGCGAGTATGTTCTGCTCCACGAAAAAAGGATGAGCCGCACGATGCACCAAGAAGTGGCAAATCCCTAGATGACATAAATCTGCTACGGAACACGGCCAACGGCGCTGGAGATTGTACCCGTTCAAGTACCCGTTCAAGGGCGAAACAGCACACGCTCCATATTCATCGGCAGAGTAGAGTTGCTTTCTGGTTGGACGCGA

Full Affymetrix probeset data:

Annotations for 1639801_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720