Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639803_at:

>probe:Drosophila_2:1639803_at:564:307; Interrogation_Position=2201; Antisense; CCAACTTTTGCGCTGGTACGAAAAG
>probe:Drosophila_2:1639803_at:63:323; Interrogation_Position=2210; Antisense; GCGCTGGTACGAAAAGACTGTTTAT
>probe:Drosophila_2:1639803_at:587:151; Interrogation_Position=2303; Antisense; ACATATGTATAGTTGCGCTGCCGCC
>probe:Drosophila_2:1639803_at:582:699; Interrogation_Position=2328; Antisense; TTTTAAGCACTCACCACAGACCGTA
>probe:Drosophila_2:1639803_at:697:257; Interrogation_Position=2342; Antisense; CACAGACCGTAGAAGGTTCATTTTT
>probe:Drosophila_2:1639803_at:535:491; Interrogation_Position=2374; Antisense; GTAACATTATTTCCATTCGTCGCTT
>probe:Drosophila_2:1639803_at:243:19; Interrogation_Position=2382; Antisense; ATTTCCATTCGTCGCTTGATAAAAG
>probe:Drosophila_2:1639803_at:690:653; Interrogation_Position=2576; Antisense; TAACTCTAGTTTTAAATCGAAGCCA
>probe:Drosophila_2:1639803_at:693:39; Interrogation_Position=2591; Antisense; ATCGAAGCCAACCAACTCTTAACTA
>probe:Drosophila_2:1639803_at:237:127; Interrogation_Position=2601; Antisense; ACCAACTCTTAACTATACTCTATCC
>probe:Drosophila_2:1639803_at:624:629; Interrogation_Position=2650; Antisense; TCCCCTTATCCCCTATTATTATTGT
>probe:Drosophila_2:1639803_at:445:703; Interrogation_Position=2668; Antisense; TTATTGTACGCAAGGCCCATGTGCT
>probe:Drosophila_2:1639803_at:442:301; Interrogation_Position=2683; Antisense; CCCATGTGCTGGAACACACGAAAAC
>probe:Drosophila_2:1639803_at:451:471; Interrogation_Position=2751; Antisense; GTATATTTGCTAACGGAATTACGAT

Paste this into a BLAST search page for me
CCAACTTTTGCGCTGGTACGAAAAGGCGCTGGTACGAAAAGACTGTTTATACATATGTATAGTTGCGCTGCCGCCTTTTAAGCACTCACCACAGACCGTACACAGACCGTAGAAGGTTCATTTTTGTAACATTATTTCCATTCGTCGCTTATTTCCATTCGTCGCTTGATAAAAGTAACTCTAGTTTTAAATCGAAGCCAATCGAAGCCAACCAACTCTTAACTAACCAACTCTTAACTATACTCTATCCTCCCCTTATCCCCTATTATTATTGTTTATTGTACGCAAGGCCCATGTGCTCCCATGTGCTGGAACACACGAAAACGTATATTTGCTAACGGAATTACGAT

Full Affymetrix probeset data:

Annotations for 1639803_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime