FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639805_at:

>probe:Drosophila_2:1639805_at:726:707; Interrogation_Position=1017; Antisense; TTACGAGGCGCCATCGCAGAATTGC
>probe:Drosophila_2:1639805_at:698:349; Interrogation_Position=1032; Antisense; GCAGAATTGCTACCAACCGGCGGCT
>probe:Drosophila_2:1639805_at:30:317; Interrogation_Position=1103; Antisense; GCCTTTCGCTCATAGATCAGCCATA
>probe:Drosophila_2:1639805_at:719:21; Interrogation_Position=1125; Antisense; ATATCGAGTGGCTCCGGAACTGTTC
>probe:Drosophila_2:1639805_at:215:621; Interrogation_Position=1148; Antisense; TCGAGGAATACAACTACCGCCTGGC
>probe:Drosophila_2:1639805_at:101:307; Interrogation_Position=1173; Antisense; CCTTGCCTCCCAGAATATTTTGTAG
>probe:Drosophila_2:1639805_at:655:53; Interrogation_Position=602; Antisense; ATGCAGGCTATGTAGCACCGGCAGC
>probe:Drosophila_2:1639805_at:379:315; Interrogation_Position=751; Antisense; GCCTACGAAGCACCTACAACTGATT
>probe:Drosophila_2:1639805_at:298:665; Interrogation_Position=765; Antisense; TACAACTGATTACAGTGCTCCCGCT
>probe:Drosophila_2:1639805_at:126:157; Interrogation_Position=852; Antisense; ACAGCCAAGCTACGTTGGTGCACCA
>probe:Drosophila_2:1639805_at:306:503; Interrogation_Position=869; Antisense; GTGCACCACCGGCACAGATCGTTTA
>probe:Drosophila_2:1639805_at:403:97; Interrogation_Position=884; Antisense; AGATCGTTTACCAGCCCATCATCTA
>probe:Drosophila_2:1639805_at:292:145; Interrogation_Position=916; Antisense; ACTCCACTGGCATCGAAGTCGTCCA
>probe:Drosophila_2:1639805_at:402:255; Interrogation_Position=964; Antisense; CAGAAATATGTCACTCCAACAGCCC

Paste this into a BLAST search page for me
TTACGAGGCGCCATCGCAGAATTGCGCAGAATTGCTACCAACCGGCGGCTGCCTTTCGCTCATAGATCAGCCATAATATCGAGTGGCTCCGGAACTGTTCTCGAGGAATACAACTACCGCCTGGCCCTTGCCTCCCAGAATATTTTGTAGATGCAGGCTATGTAGCACCGGCAGCGCCTACGAAGCACCTACAACTGATTTACAACTGATTACAGTGCTCCCGCTACAGCCAAGCTACGTTGGTGCACCAGTGCACCACCGGCACAGATCGTTTAAGATCGTTTACCAGCCCATCATCTAACTCCACTGGCATCGAAGTCGTCCACAGAAATATGTCACTCCAACAGCCC

Full Affymetrix probeset data:

Annotations for 1639805_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720