Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639808_at:

>probe:Drosophila_2:1639808_at:270:545; Interrogation_Position=1350; Antisense; GGATCAGTTCTACGCCAGCAATGGC
>probe:Drosophila_2:1639808_at:628:617; Interrogation_Position=1424; Antisense; TGCAGCTCTGGCAGTTTCTGGTGGC
>probe:Drosophila_2:1639808_at:477:131; Interrogation_Position=1492; Antisense; ACCGGTCGTGGCATGGAGTTCAAGC
>probe:Drosophila_2:1639808_at:337:627; Interrogation_Position=1553; Antisense; TCCAGAAGAATCGACCCGCCATGAA
>probe:Drosophila_2:1639808_at:249:293; Interrogation_Position=1581; Antisense; CGACAAGTTATCTCGCAGTTTGCGC
>probe:Drosophila_2:1639808_at:238:351; Interrogation_Position=1595; Antisense; GCAGTTTGCGCTACTACTACGAGAA
>probe:Drosophila_2:1639808_at:464:197; Interrogation_Position=1639; Antisense; AACGGAGAGCGCTACGTCTATCGGT
>probe:Drosophila_2:1639808_at:699:679; Interrogation_Position=1657; Antisense; TATCGGTTCGTCTGCGATCCGGATG
>probe:Drosophila_2:1639808_at:545:449; Interrogation_Position=1672; Antisense; GATCCGGATGCGCTGTTCAACATGG
>probe:Drosophila_2:1639808_at:66:713; Interrogation_Position=1687; Antisense; TTCAACATGGCCTACGGTCACCTGA
>probe:Drosophila_2:1639808_at:322:81; Interrogation_Position=1727; Antisense; AGGGTGACCAGCACCAGTTGACGCT
>probe:Drosophila_2:1639808_at:700:93; Interrogation_Position=1742; Antisense; AGTTGACGCTGTCGCTGGCCAAGAC
>probe:Drosophila_2:1639808_at:641:307; Interrogation_Position=1801; Antisense; CCACGAGTCGCCAAGTCGGAGTATT
>probe:Drosophila_2:1639808_at:283:549; Interrogation_Position=1818; Antisense; GGAGTATTACGATACCGCCGCATTG

Paste this into a BLAST search page for me
GGATCAGTTCTACGCCAGCAATGGCTGCAGCTCTGGCAGTTTCTGGTGGCACCGGTCGTGGCATGGAGTTCAAGCTCCAGAAGAATCGACCCGCCATGAACGACAAGTTATCTCGCAGTTTGCGCGCAGTTTGCGCTACTACTACGAGAAAACGGAGAGCGCTACGTCTATCGGTTATCGGTTCGTCTGCGATCCGGATGGATCCGGATGCGCTGTTCAACATGGTTCAACATGGCCTACGGTCACCTGAAGGGTGACCAGCACCAGTTGACGCTAGTTGACGCTGTCGCTGGCCAAGACCCACGAGTCGCCAAGTCGGAGTATTGGAGTATTACGATACCGCCGCATTG

Full Affymetrix probeset data:

Annotations for 1639808_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime