Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639809_at:

>probe:Drosophila_2:1639809_at:89:105; Interrogation_Position=113; Antisense; AGACCCTGAGGGAGTTGACCGCATC
>probe:Drosophila_2:1639809_at:230:95; Interrogation_Position=125; Antisense; AGTTGACCGCATCCGAGGAACTGAC
>probe:Drosophila_2:1639809_at:446:207; Interrogation_Position=199; Antisense; AAGCTGACCTTCATTGTCCTGGATG
>probe:Drosophila_2:1639809_at:251:265; Interrogation_Position=224; Antisense; CAGAGACTTATTCGCGTGATCAGGA
>probe:Drosophila_2:1639809_at:367:215; Interrogation_Position=293; Antisense; AAGATCCCGATAGCCAGATACCAAC
>probe:Drosophila_2:1639809_at:723:557; Interrogation_Position=327; Antisense; GGAAATCATGATTGCCGAACCTTAT
>probe:Drosophila_2:1639809_at:475:213; Interrogation_Position=36; Antisense; AATACTGGGTCACAGGGTCATCCTT
>probe:Drosophila_2:1639809_at:109:463; Interrogation_Position=365; Antisense; GATTCGGCAGGGAAGCCATGCTCCT
>probe:Drosophila_2:1639809_at:308:235; Interrogation_Position=407; Antisense; AATCGCAGCCCCAGCTTAAATTGGA
>probe:Drosophila_2:1639809_at:198:215; Interrogation_Position=445; Antisense; AAGATCGACATGGACAACGCTGCAT
>probe:Drosophila_2:1639809_at:44:135; Interrogation_Position=461; Antisense; ACGCTGCATCGCTGCATTTGTTTAA
>probe:Drosophila_2:1639809_at:692:103; Interrogation_Position=503; Antisense; AGACGCGTCGAGTGGAGATCTTCCA
>probe:Drosophila_2:1639809_at:153:123; Interrogation_Position=542; Antisense; AGCGACCTATCACTCCAGATTGGAT
>probe:Drosophila_2:1639809_at:281:433; Interrogation_Position=97; Antisense; GAGTGGATGAGCAACGAGACCCTGA

Paste this into a BLAST search page for me
AGACCCTGAGGGAGTTGACCGCATCAGTTGACCGCATCCGAGGAACTGACAAGCTGACCTTCATTGTCCTGGATGCAGAGACTTATTCGCGTGATCAGGAAAGATCCCGATAGCCAGATACCAACGGAAATCATGATTGCCGAACCTTATAATACTGGGTCACAGGGTCATCCTTGATTCGGCAGGGAAGCCATGCTCCTAATCGCAGCCCCAGCTTAAATTGGAAAGATCGACATGGACAACGCTGCATACGCTGCATCGCTGCATTTGTTTAAAGACGCGTCGAGTGGAGATCTTCCAAGCGACCTATCACTCCAGATTGGATGAGTGGATGAGCAACGAGACCCTGA

Full Affymetrix probeset data:

Annotations for 1639809_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime