FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639810_at:

>probe:Drosophila_2:1639810_at:622:547; Interrogation_Position=1639; Antisense; GGATGTTGTGCTCTCATATGAGACA
>probe:Drosophila_2:1639810_at:115:25; Interrogation_Position=1654; Antisense; ATATGAGACACCTCGCCATATCACG
>probe:Drosophila_2:1639810_at:448:299; Interrogation_Position=1667; Antisense; CGCCATATCACGACATACATTCATC
>probe:Drosophila_2:1639810_at:158:115; Interrogation_Position=1683; Antisense; ACATTCATCGAGTGGGCCGAACGGC
>probe:Drosophila_2:1639810_at:191:559; Interrogation_Position=1715; Antisense; GGAAGAAAGGGCACCGCCGTCACCG
>probe:Drosophila_2:1639810_at:315:507; Interrogation_Position=1739; Antisense; GTGCTCACGGAACAAGATATGACTT
>probe:Drosophila_2:1639810_at:706:437; Interrogation_Position=1805; Antisense; GAGGAAATCCACGTTTCTCCAGATA
>probe:Drosophila_2:1639810_at:49:159; Interrogation_Position=1854; Antisense; ACAAAGAGGCTTTAGCCGGCCTGCG
>probe:Drosophila_2:1639810_at:172:699; Interrogation_Position=1864; Antisense; TTTAGCCGGCCTGCGCTCGGAAAAG
>probe:Drosophila_2:1639810_at:198:377; Interrogation_Position=1918; Antisense; GAAGAATCGTGTGGCCACCAAGGCA
>probe:Drosophila_2:1639810_at:478:517; Interrogation_Position=1926; Antisense; GTGTGGCCACCAAGGCATTGATCCA
>probe:Drosophila_2:1639810_at:700:547; Interrogation_Position=1960; Antisense; GGAGGAAACGGCCACAGTTCGTCCA
>probe:Drosophila_2:1639810_at:1:473; Interrogation_Position=1976; Antisense; GTTCGTCCACTGACGTTGATGGAAA
>probe:Drosophila_2:1639810_at:291:157; Interrogation_Position=2128; Antisense; ACAACTTAAGGCCATCGAGAACTAA

Paste this into a BLAST search page for me
GGATGTTGTGCTCTCATATGAGACAATATGAGACACCTCGCCATATCACGCGCCATATCACGACATACATTCATCACATTCATCGAGTGGGCCGAACGGCGGAAGAAAGGGCACCGCCGTCACCGGTGCTCACGGAACAAGATATGACTTGAGGAAATCCACGTTTCTCCAGATAACAAAGAGGCTTTAGCCGGCCTGCGTTTAGCCGGCCTGCGCTCGGAAAAGGAAGAATCGTGTGGCCACCAAGGCAGTGTGGCCACCAAGGCATTGATCCAGGAGGAAACGGCCACAGTTCGTCCAGTTCGTCCACTGACGTTGATGGAAAACAACTTAAGGCCATCGAGAACTAA

Full Affymetrix probeset data:

Annotations for 1639810_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720