Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639811_at:

>probe:Drosophila_2:1639811_at:286:487; Interrogation_Position=1937; Antisense; GTAGCTTCTACAATTTCATAACTCA
>probe:Drosophila_2:1639811_at:701:471; Interrogation_Position=1977; Antisense; GTTCTACATTTCTACGATAGCTTTT
>probe:Drosophila_2:1639811_at:673:243; Interrogation_Position=2047; Antisense; AATTATTACCTGTGCTTCTTTTAGA
>probe:Drosophila_2:1639811_at:722:167; Interrogation_Position=2095; Antisense; AAATGTTTTGACACCATGTCTGAAT
>probe:Drosophila_2:1639811_at:670:59; Interrogation_Position=2110; Antisense; ATGTCTGAATGCGTTTTTCCCTAAC
>probe:Drosophila_2:1639811_at:68:689; Interrogation_Position=2125; Antisense; TTTCCCTAACTTATTGCCCTGGAGA
>probe:Drosophila_2:1639811_at:652:81; Interrogation_Position=2186; Antisense; AGGGCTACATTTCTGGTTACTCGAC
>probe:Drosophila_2:1639811_at:452:385; Interrogation_Position=2286; Antisense; GAACTTATCTATATGGCTAGCCCTT
>probe:Drosophila_2:1639811_at:250:321; Interrogation_Position=2305; Antisense; GCCCTTTCTATGCTATCTCTTTTAA
>probe:Drosophila_2:1639811_at:379:1; Interrogation_Position=2379; Antisense; TTCCTGGGAAACACTTTCACTTAAT
>probe:Drosophila_2:1639811_at:713:653; Interrogation_Position=2409; Antisense; TAATATCTGGTTTTCATTACCGGGT
>probe:Drosophila_2:1639811_at:438:703; Interrogation_Position=2425; Antisense; TTACCGGGTATTCCCTGGTCCATCA
>probe:Drosophila_2:1639811_at:275:629; Interrogation_Position=2443; Antisense; TCCATCACCCCTAGACCAAGTTTTT
>probe:Drosophila_2:1639811_at:296:689; Interrogation_Position=2474; Antisense; TATTTATGACGTGCGTGTGACCCCA

Paste this into a BLAST search page for me
GTAGCTTCTACAATTTCATAACTCAGTTCTACATTTCTACGATAGCTTTTAATTATTACCTGTGCTTCTTTTAGAAAATGTTTTGACACCATGTCTGAATATGTCTGAATGCGTTTTTCCCTAACTTTCCCTAACTTATTGCCCTGGAGAAGGGCTACATTTCTGGTTACTCGACGAACTTATCTATATGGCTAGCCCTTGCCCTTTCTATGCTATCTCTTTTAATTCCTGGGAAACACTTTCACTTAATTAATATCTGGTTTTCATTACCGGGTTTACCGGGTATTCCCTGGTCCATCATCCATCACCCCTAGACCAAGTTTTTTATTTATGACGTGCGTGTGACCCCA

Full Affymetrix probeset data:

Annotations for 1639811_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime