FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639812_at:

>probe:Drosophila_2:1639812_at:561:211; Interrogation_Position=1429; Antisense; AAGACAGAGGTTTCCGAGCTTCAAC
>probe:Drosophila_2:1639812_at:535:691; Interrogation_Position=1488; Antisense; TTTGGAGCGCAAGTTGGCCCAGCAT
>probe:Drosophila_2:1639812_at:230:467; Interrogation_Position=1500; Antisense; GTTGGCCCAGCATACAGCTAAGCTA
>probe:Drosophila_2:1639812_at:179:121; Interrogation_Position=1553; Antisense; AGCGTGAGTTGTCCAAGGCACTGCA
>probe:Drosophila_2:1639812_at:213:103; Interrogation_Position=1586; Antisense; AGAGCTCCTGGCACGGCAAATACAA
>probe:Drosophila_2:1639812_at:352:197; Interrogation_Position=1630; Antisense; AACGAGTTCAAGCAAACCCACGACG
>probe:Drosophila_2:1639812_at:572:225; Interrogation_Position=1672; Antisense; AAGGAACAGCTTCGCGACATTATGT
>probe:Drosophila_2:1639812_at:29:217; Interrogation_Position=1717; Antisense; AAGTTGGCCAACACCGAGATAGCGG
>probe:Drosophila_2:1639812_at:131:533; Interrogation_Position=1741; Antisense; GGTGGCACCGTTACAGGCATTGCAG
>probe:Drosophila_2:1639812_at:60:289; Interrogation_Position=1789; Antisense; CGGCGCCGTAATCGTCGCAAGAAAT
>probe:Drosophila_2:1639812_at:449:29; Interrogation_Position=1812; Antisense; ATAAATCATAGCCACCGTACGCCGT
>probe:Drosophila_2:1639812_at:66:489; Interrogation_Position=1828; Antisense; GTACGCCGTCTTTATATCCAAGCTG
>probe:Drosophila_2:1639812_at:464:333; Interrogation_Position=1849; Antisense; GCTGCATTGTTTACCCGATCTTAGA
>probe:Drosophila_2:1639812_at:663:261; Interrogation_Position=1907; Antisense; CAGCTCTATATGTGATTTCCTTTGT

Paste this into a BLAST search page for me
AAGACAGAGGTTTCCGAGCTTCAACTTTGGAGCGCAAGTTGGCCCAGCATGTTGGCCCAGCATACAGCTAAGCTAAGCGTGAGTTGTCCAAGGCACTGCAAGAGCTCCTGGCACGGCAAATACAAAACGAGTTCAAGCAAACCCACGACGAAGGAACAGCTTCGCGACATTATGTAAGTTGGCCAACACCGAGATAGCGGGGTGGCACCGTTACAGGCATTGCAGCGGCGCCGTAATCGTCGCAAGAAATATAAATCATAGCCACCGTACGCCGTGTACGCCGTCTTTATATCCAAGCTGGCTGCATTGTTTACCCGATCTTAGACAGCTCTATATGTGATTTCCTTTGT

Full Affymetrix probeset data:

Annotations for 1639812_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720