Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639813_at:

>probe:Drosophila_2:1639813_at:669:161; Interrogation_Position=5544; Antisense; ACAATGCTTACCACAGCGTCAGAAG
>probe:Drosophila_2:1639813_at:529:75; Interrogation_Position=5585; Antisense; AGGAGATTCTGTGGAGGTCCCCATC
>probe:Drosophila_2:1639813_at:689:433; Interrogation_Position=5598; Antisense; GAGGTCCCCATCAAACGAAAGGCGT
>probe:Drosophila_2:1639813_at:328:169; Interrogation_Position=5615; Antisense; AAAGGCGTCAACTCGCAGAGGTTCA
>probe:Drosophila_2:1639813_at:31:425; Interrogation_Position=5647; Antisense; GAGACACGCCGATATCATCAGTTAA
>probe:Drosophila_2:1639813_at:392:33; Interrogation_Position=5663; Antisense; ATCAGTTAACGCTTCCGATGAAAGT
>probe:Drosophila_2:1639813_at:619:505; Interrogation_Position=5686; Antisense; GTGCGGTTCTGGAATCGGTTCCTAA
>probe:Drosophila_2:1639813_at:615:429; Interrogation_Position=5723; Antisense; GAGTAACATCAGTAGCGTACCAGCT
>probe:Drosophila_2:1639813_at:351:233; Interrogation_Position=5787; Antisense; AATGCTATTGAAATCATCCCGCCAA
>probe:Drosophila_2:1639813_at:708:299; Interrogation_Position=5856; Antisense; CGCGCTGCTCCTTCTGATATAGAAA
>probe:Drosophila_2:1639813_at:282:149; Interrogation_Position=5938; Antisense; ACTTTAATCTTCGTCTACTGCTCAT
>probe:Drosophila_2:1639813_at:465:389; Interrogation_Position=6016; Antisense; GACAGGGTCCTCTGCAATGTGGATT
>probe:Drosophila_2:1639813_at:270:605; Interrogation_Position=6056; Antisense; TGATAAGAACAATTGGCAGCGCCAT
>probe:Drosophila_2:1639813_at:522:353; Interrogation_Position=6071; Antisense; GCAGCGCCATATAGGAGAGCATTAT

Paste this into a BLAST search page for me
ACAATGCTTACCACAGCGTCAGAAGAGGAGATTCTGTGGAGGTCCCCATCGAGGTCCCCATCAAACGAAAGGCGTAAAGGCGTCAACTCGCAGAGGTTCAGAGACACGCCGATATCATCAGTTAAATCAGTTAACGCTTCCGATGAAAGTGTGCGGTTCTGGAATCGGTTCCTAAGAGTAACATCAGTAGCGTACCAGCTAATGCTATTGAAATCATCCCGCCAACGCGCTGCTCCTTCTGATATAGAAAACTTTAATCTTCGTCTACTGCTCATGACAGGGTCCTCTGCAATGTGGATTTGATAAGAACAATTGGCAGCGCCATGCAGCGCCATATAGGAGAGCATTAT

Full Affymetrix probeset data:

Annotations for 1639813_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime