Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639816_at:

>probe:Drosophila_2:1639816_at:198:23; Interrogation_Position=5749; Antisense; ATATCCGGTCATGCCGCGAGACTAT
>probe:Drosophila_2:1639816_at:564:523; Interrogation_Position=5836; Antisense; GGGCCGACTGTCGATTGTACATAAA
>probe:Drosophila_2:1639816_at:473:187; Interrogation_Position=5860; Antisense; AACACTTAGACTTAAGCCCGGCTGG
>probe:Drosophila_2:1639816_at:281:581; Interrogation_Position=5900; Antisense; TGGCCAGCCACTCGACACAGTAAAA
>probe:Drosophila_2:1639816_at:666:707; Interrogation_Position=5944; Antisense; TTAAGCGTAGCTCCATACACCTGTA
>probe:Drosophila_2:1639816_at:338:687; Interrogation_Position=6009; Antisense; TATACATCCGATCGCACAGAGGGCC
>probe:Drosophila_2:1639816_at:619:287; Interrogation_Position=6033; Antisense; CGGCATTGCATCATCCAGGGTTTAG
>probe:Drosophila_2:1639816_at:601:565; Interrogation_Position=6059; Antisense; GGCAATACCTGCAACCTAATCTTAG
>probe:Drosophila_2:1639816_at:421:487; Interrogation_Position=6102; Antisense; GTAGCGTAGGCTTTAACTCGTCCTT
>probe:Drosophila_2:1639816_at:184:505; Interrogation_Position=6121; Antisense; GTCCTTCATCATTGCGGAACATCGT
>probe:Drosophila_2:1639816_at:702:561; Interrogation_Position=6136; Antisense; GGAACATCGTTTTTATACTGGCCAA
>probe:Drosophila_2:1639816_at:317:685; Interrogation_Position=6149; Antisense; TATACTGGCCAACTGCACGGAAGAT
>probe:Drosophila_2:1639816_at:486:335; Interrogation_Position=6181; Antisense; GCTGCGAATGCATGCTGTGTGGTTT
>probe:Drosophila_2:1639816_at:245:257; Interrogation_Position=6217; Antisense; CACGGTGCGAACCAGTCGTTCAAAA

Paste this into a BLAST search page for me
ATATCCGGTCATGCCGCGAGACTATGGGCCGACTGTCGATTGTACATAAAAACACTTAGACTTAAGCCCGGCTGGTGGCCAGCCACTCGACACAGTAAAATTAAGCGTAGCTCCATACACCTGTATATACATCCGATCGCACAGAGGGCCCGGCATTGCATCATCCAGGGTTTAGGGCAATACCTGCAACCTAATCTTAGGTAGCGTAGGCTTTAACTCGTCCTTGTCCTTCATCATTGCGGAACATCGTGGAACATCGTTTTTATACTGGCCAATATACTGGCCAACTGCACGGAAGATGCTGCGAATGCATGCTGTGTGGTTTCACGGTGCGAACCAGTCGTTCAAAA

Full Affymetrix probeset data:

Annotations for 1639816_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime