Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639817_at:

>probe:Drosophila_2:1639817_at:433:249; Interrogation_Position=116; Antisense; CAATGACGAAGAGCCATCCTGTAGT
>probe:Drosophila_2:1639817_at:401:211; Interrogation_Position=180; Antisense; AAGAAATGGGTTGCGCACGCCATGT
>probe:Drosophila_2:1639817_at:389:83; Interrogation_Position=221; Antisense; AGTGGACAACTGTGCCATCTGCCGT
>probe:Drosophila_2:1639817_at:352:625; Interrogation_Position=240; Antisense; TGCCGTAACCACATCATGAACCTGT
>probe:Drosophila_2:1639817_at:5:287; Interrogation_Position=261; Antisense; CTGTGCATCGAGTGCCAGGCGGACC
>probe:Drosophila_2:1639817_at:316:71; Interrogation_Position=277; Antisense; AGGCGGACCCGAATGCAAACCAAGA
>probe:Drosophila_2:1639817_at:237:175; Interrogation_Position=293; Antisense; AAACCAAGACGAGTGCACTGTGGCT
>probe:Drosophila_2:1639817_at:53:327; Interrogation_Position=322; Antisense; GCGAGTGCAACCACGCATTCCATTA
>probe:Drosophila_2:1639817_at:701:283; Interrogation_Position=350; Antisense; CTGCATCGCGCGCTGGTTGAAAACG
>probe:Drosophila_2:1639817_at:87:725; Interrogation_Position=366; Antisense; TTGAAAACGCGCCTGGTCTGTCCGC
>probe:Drosophila_2:1639817_at:612:529; Interrogation_Position=406; Antisense; GGGTCTACCAGAAGTACGGCCGCTA
>probe:Drosophila_2:1639817_at:171:289; Interrogation_Position=422; Antisense; CGGCCGCTAGCGAGGAATATGGATC
>probe:Drosophila_2:1639817_at:619:493; Interrogation_Position=50; Antisense; GTAATTTCACACCATGGCCGAGGAG
>probe:Drosophila_2:1639817_at:109:437; Interrogation_Position=93; Antisense; GAGGACTTCCACGACATGGACTTCA

Paste this into a BLAST search page for me
CAATGACGAAGAGCCATCCTGTAGTAAGAAATGGGTTGCGCACGCCATGTAGTGGACAACTGTGCCATCTGCCGTTGCCGTAACCACATCATGAACCTGTCTGTGCATCGAGTGCCAGGCGGACCAGGCGGACCCGAATGCAAACCAAGAAAACCAAGACGAGTGCACTGTGGCTGCGAGTGCAACCACGCATTCCATTACTGCATCGCGCGCTGGTTGAAAACGTTGAAAACGCGCCTGGTCTGTCCGCGGGTCTACCAGAAGTACGGCCGCTACGGCCGCTAGCGAGGAATATGGATCGTAATTTCACACCATGGCCGAGGAGGAGGACTTCCACGACATGGACTTCA

Full Affymetrix probeset data:

Annotations for 1639817_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime