FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639819_at:

>probe:Drosophila_2:1639819_at:700:209; Interrogation_Position=2180; Antisense; AAGAAGGATTGTGCTGCCGTCTATC
>probe:Drosophila_2:1639819_at:150:77; Interrogation_Position=2232; Antisense; AGGATTTGCGCAATGCTGGCTACCG
>probe:Drosophila_2:1639819_at:634:271; Interrogation_Position=2291; Antisense; CATCTATGGAGCTTCGATCTGCGAC
>probe:Drosophila_2:1639819_at:326:333; Interrogation_Position=2336; Antisense; GCTGGCTTGGGATTCACATGTCGCA
>probe:Drosophila_2:1639819_at:16:379; Interrogation_Position=2422; Antisense; GAAGCGACTGGTCTACTTGACGCTC
>probe:Drosophila_2:1639819_at:453:431; Interrogation_Position=2478; Antisense; GAGTCTACCGAAATGGCGAGCCCGT
>probe:Drosophila_2:1639819_at:54:417; Interrogation_Position=2495; Antisense; GAGCCCGTGGGCATACTTAGACGAG
>probe:Drosophila_2:1639819_at:101:335; Interrogation_Position=2519; Antisense; GCTGAATATGCCTATACCCTTGGAA
>probe:Drosophila_2:1639819_at:156:681; Interrogation_Position=2538; Antisense; TTGGAAAGTCCCTCGGTCAGACATA
>probe:Drosophila_2:1639819_at:201:27; Interrogation_Position=2560; Antisense; ATACGTGTCCCGACCAGATGGCAAG
>probe:Drosophila_2:1639819_at:13:91; Interrogation_Position=2616; Antisense; AGTACGAGGTGGACATCTTGGGCAA
>probe:Drosophila_2:1639819_at:77:1; Interrogation_Position=2687; Antisense; GGCCAACGGGTTCTCGGTAACTATG
>probe:Drosophila_2:1639819_at:425:537; Interrogation_Position=2702; Antisense; GGTAACTATGCATCCGAGTCCAAGT
>probe:Drosophila_2:1639819_at:278:171; Interrogation_Position=2736; Antisense; AAAGATTAGTCTCTTCCACTTCCAA

Paste this into a BLAST search page for me
AAGAAGGATTGTGCTGCCGTCTATCAGGATTTGCGCAATGCTGGCTACCGCATCTATGGAGCTTCGATCTGCGACGCTGGCTTGGGATTCACATGTCGCAGAAGCGACTGGTCTACTTGACGCTCGAGTCTACCGAAATGGCGAGCCCGTGAGCCCGTGGGCATACTTAGACGAGGCTGAATATGCCTATACCCTTGGAATTGGAAAGTCCCTCGGTCAGACATAATACGTGTCCCGACCAGATGGCAAGAGTACGAGGTGGACATCTTGGGCAAGGCCAACGGGTTCTCGGTAACTATGGGTAACTATGCATCCGAGTCCAAGTAAAGATTAGTCTCTTCCACTTCCAA

Full Affymetrix probeset data:

Annotations for 1639819_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720