FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639821_at:

>probe:Drosophila_2:1639821_at:381:643; Interrogation_Position=1963; Antisense; TCTACAAGGGATTCAGACGCAAGCT
>probe:Drosophila_2:1639821_at:116:105; Interrogation_Position=1977; Antisense; AGACGCAAGCTAATGGACACAACCA
>probe:Drosophila_2:1639821_at:11:203; Interrogation_Position=1997; Antisense; AACCATGATACCATTGGGTCCCAAA
>probe:Drosophila_2:1639821_at:72:423; Interrogation_Position=2041; Antisense; GAGACAAGGCCGCAAATAGCGCTCT
>probe:Drosophila_2:1639821_at:248:27; Interrogation_Position=2056; Antisense; ATAGCGCTCTGGCTAAGCTCAAAAA
>probe:Drosophila_2:1639821_at:136:171; Interrogation_Position=2078; Antisense; AAAGAGTCTCATCAACAAGCCGCTG
>probe:Drosophila_2:1639821_at:365:205; Interrogation_Position=2094; Antisense; AAGCCGCTGGTCTCGATTAGCTGAG
>probe:Drosophila_2:1639821_at:502:119; Interrogation_Position=2112; Antisense; AGCTGAGCTCGAAAGTAATCTAAGA
>probe:Drosophila_2:1639821_at:250:245; Interrogation_Position=2163; Antisense; AATTTCACTATTGCCTATCTATTGG
>probe:Drosophila_2:1639821_at:614:315; Interrogation_Position=2175; Antisense; GCCTATCTATTGGTATCTATTTCTA
>probe:Drosophila_2:1639821_at:83:461; Interrogation_Position=2236; Antisense; GATTTATGGACTGTGCATTCCTTTT
>probe:Drosophila_2:1639821_at:665:489; Interrogation_Position=2363; Antisense; GTAAACTTATTGCAGTACGCAGGCA
>probe:Drosophila_2:1639821_at:574:385; Interrogation_Position=2409; Antisense; GAACAACTTAACCAAGGCTCTTAAT
>probe:Drosophila_2:1639821_at:621:309; Interrogation_Position=2466; Antisense; GCCAAAATTCTATATCAAACGCCAA

Paste this into a BLAST search page for me
TCTACAAGGGATTCAGACGCAAGCTAGACGCAAGCTAATGGACACAACCAAACCATGATACCATTGGGTCCCAAAGAGACAAGGCCGCAAATAGCGCTCTATAGCGCTCTGGCTAAGCTCAAAAAAAAGAGTCTCATCAACAAGCCGCTGAAGCCGCTGGTCTCGATTAGCTGAGAGCTGAGCTCGAAAGTAATCTAAGAAATTTCACTATTGCCTATCTATTGGGCCTATCTATTGGTATCTATTTCTAGATTTATGGACTGTGCATTCCTTTTGTAAACTTATTGCAGTACGCAGGCAGAACAACTTAACCAAGGCTCTTAATGCCAAAATTCTATATCAAACGCCAA

Full Affymetrix probeset data:

Annotations for 1639821_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720