Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639822_at:

>probe:Drosophila_2:1639822_at:159:631; Interrogation_Position=4017; Antisense; TCGCCACATATTGAATTCACCGCTT
>probe:Drosophila_2:1639822_at:29:711; Interrogation_Position=4032; Antisense; TTCACCGCTTTTGAATCGGCGTCAG
>probe:Drosophila_2:1639822_at:33:67; Interrogation_Position=4142; Antisense; ATGGCAAGCAGTATCGCGACCTGGA
>probe:Drosophila_2:1639822_at:395:413; Interrogation_Position=4167; Antisense; GACCTTCCAAAAAGCTCAACTGCGT
>probe:Drosophila_2:1639822_at:688:463; Interrogation_Position=4212; Antisense; GATTGAACCCAATGGCAGTGCTAGT
>probe:Drosophila_2:1639822_at:111:267; Interrogation_Position=4227; Antisense; CAGTGCTAGTTGTGCCAATCCGGCG
>probe:Drosophila_2:1639822_at:446:299; Interrogation_Position=4250; Antisense; CGCCAGTGCGTCGTGAATTTGTGAT
>probe:Drosophila_2:1639822_at:105:597; Interrogation_Position=4269; Antisense; TGTGATGCACAACAAGGCGCCCATG
>probe:Drosophila_2:1639822_at:411:601; Interrogation_Position=4313; Antisense; TGTACCAGCTGGACTTTGGCGGACG
>probe:Drosophila_2:1639822_at:661:327; Interrogation_Position=4337; Antisense; GCGTTACCCAGGAGTCAGCCAAGAA
>probe:Drosophila_2:1639822_at:363:197; Interrogation_Position=4368; Antisense; AATCGAGTTTCGTGGCAAGCAGGTC
>probe:Drosophila_2:1639822_at:271:209; Interrogation_Position=4384; Antisense; AAGCAGGTCATGCAATTCGGTCGCA
>probe:Drosophila_2:1639822_at:313:441; Interrogation_Position=4411; Antisense; GATGGAAATGCCTATACCCTGGATT
>probe:Drosophila_2:1639822_at:598:521; Interrogation_Position=4471; Antisense; GTGGCTCTGGCCAATGTGACACAGC

Paste this into a BLAST search page for me
TCGCCACATATTGAATTCACCGCTTTTCACCGCTTTTGAATCGGCGTCAGATGGCAAGCAGTATCGCGACCTGGAGACCTTCCAAAAAGCTCAACTGCGTGATTGAACCCAATGGCAGTGCTAGTCAGTGCTAGTTGTGCCAATCCGGCGCGCCAGTGCGTCGTGAATTTGTGATTGTGATGCACAACAAGGCGCCCATGTGTACCAGCTGGACTTTGGCGGACGGCGTTACCCAGGAGTCAGCCAAGAAAATCGAGTTTCGTGGCAAGCAGGTCAAGCAGGTCATGCAATTCGGTCGCAGATGGAAATGCCTATACCCTGGATTGTGGCTCTGGCCAATGTGACACAGC

Full Affymetrix probeset data:

Annotations for 1639822_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime