Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639823_at:

>probe:Drosophila_2:1639823_at:730:219; Interrogation_Position=2572; Antisense; AAGTCCAAGCTACTCATTGTCTTCG
>probe:Drosophila_2:1639823_at:116:273; Interrogation_Position=2586; Antisense; CATTGTCTTCGAGTTTCTGGAGTTT
>probe:Drosophila_2:1639823_at:404:691; Interrogation_Position=2600; Antisense; TTCTGGAGTTTTGCGAGGGTCCCAT
>probe:Drosophila_2:1639823_at:161:167; Interrogation_Position=2657; Antisense; AAATCCTGCACTCGTTCATGATGGG
>probe:Drosophila_2:1639823_at:364:317; Interrogation_Position=2686; Antisense; GCCGAGAAGTTGAATCCCCGCGAGA
>probe:Drosophila_2:1639823_at:546:45; Interrogation_Position=2713; Antisense; ATCGCCTGCATGCACTTTATGGAGC
>probe:Drosophila_2:1639823_at:318:121; Interrogation_Position=2813; Antisense; AGCTGGCGGATGTCTACCACTATAA
>probe:Drosophila_2:1639823_at:112:105; Interrogation_Position=2837; Antisense; AGACGCTTCTCAACTTCCAGGTGAA
>probe:Drosophila_2:1639823_at:502:613; Interrogation_Position=2858; Antisense; TGAACGAGTACGTGCACTCCGACGG
>probe:Drosophila_2:1639823_at:551:113; Interrogation_Position=2912; Antisense; AGCAGCGCGCTATTGTCCATTGGAA
>probe:Drosophila_2:1639823_at:160:567; Interrogation_Position=2944; Antisense; GGCAAATAGGACGACCACCCGGTGG
>probe:Drosophila_2:1639823_at:87:685; Interrogation_Position=3000; Antisense; TATCCCGCACCACGTATTATATAGT
>probe:Drosophila_2:1639823_at:173:473; Interrogation_Position=3023; Antisense; GTTAACTAGCATAACCTACCACCTA
>probe:Drosophila_2:1639823_at:679:467; Interrogation_Position=3106; Antisense; GTTGTAAGCCTTTGATTTCCAGACA

Paste this into a BLAST search page for me
AAGTCCAAGCTACTCATTGTCTTCGCATTGTCTTCGAGTTTCTGGAGTTTTTCTGGAGTTTTGCGAGGGTCCCATAAATCCTGCACTCGTTCATGATGGGGCCGAGAAGTTGAATCCCCGCGAGAATCGCCTGCATGCACTTTATGGAGCAGCTGGCGGATGTCTACCACTATAAAGACGCTTCTCAACTTCCAGGTGAATGAACGAGTACGTGCACTCCGACGGAGCAGCGCGCTATTGTCCATTGGAAGGCAAATAGGACGACCACCCGGTGGTATCCCGCACCACGTATTATATAGTGTTAACTAGCATAACCTACCACCTAGTTGTAAGCCTTTGATTTCCAGACA

Full Affymetrix probeset data:

Annotations for 1639823_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime