FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639825_at:

>probe:Drosophila_2:1639825_at:529:273; Interrogation_Position=2546; Antisense; CTTCTAAGTGCTAAGGACGGGCGAT
>probe:Drosophila_2:1639825_at:205:491; Interrogation_Position=2603; Antisense; GTACACGTACATATACACCGCTAAA
>probe:Drosophila_2:1639825_at:509:687; Interrogation_Position=2658; Antisense; TATATACGATCCAGGCTTCGCGATG
>probe:Drosophila_2:1639825_at:427:715; Interrogation_Position=2674; Antisense; TTCGCGATGTTTGTTCGGTCCCAAA
>probe:Drosophila_2:1639825_at:47:601; Interrogation_Position=2685; Antisense; TGTTCGGTCCCAAAGCCCAGATAAA
>probe:Drosophila_2:1639825_at:76:31; Interrogation_Position=2705; Antisense; ATAAAAATCACAATCCACATCCCGG
>probe:Drosophila_2:1639825_at:67:47; Interrogation_Position=2717; Antisense; ATCCACATCCCGGAGGAGTTTCGTG
>probe:Drosophila_2:1639825_at:709:429; Interrogation_Position=2732; Antisense; GAGTTTCGTGTGCTTCTGAGTTCCC
>probe:Drosophila_2:1639825_at:187:401; Interrogation_Position=2778; Antisense; GACAGATATGTGAGACCCGTGACCT
>probe:Drosophila_2:1639825_at:313:513; Interrogation_Position=2787; Antisense; GTGAGACCCGTGACCTGAAGATGAT
>probe:Drosophila_2:1639825_at:294:245; Interrogation_Position=2872; Antisense; AATTAACACGCGTAGCCACTAACTC
>probe:Drosophila_2:1639825_at:87:569; Interrogation_Position=2903; Antisense; GGCATGATAATCTTTCTCGTTACCT
>probe:Drosophila_2:1639825_at:486:555; Interrogation_Position=2938; Antisense; GGACTTTTGCTTCAGTAAATTCTCA
>probe:Drosophila_2:1639825_at:227:627; Interrogation_Position=3001; Antisense; TGCCTTTGGGCATTGTGAACGTTGT

Paste this into a BLAST search page for me
CTTCTAAGTGCTAAGGACGGGCGATGTACACGTACATATACACCGCTAAATATATACGATCCAGGCTTCGCGATGTTCGCGATGTTTGTTCGGTCCCAAATGTTCGGTCCCAAAGCCCAGATAAAATAAAAATCACAATCCACATCCCGGATCCACATCCCGGAGGAGTTTCGTGGAGTTTCGTGTGCTTCTGAGTTCCCGACAGATATGTGAGACCCGTGACCTGTGAGACCCGTGACCTGAAGATGATAATTAACACGCGTAGCCACTAACTCGGCATGATAATCTTTCTCGTTACCTGGACTTTTGCTTCAGTAAATTCTCATGCCTTTGGGCATTGTGAACGTTGT

Full Affymetrix probeset data:

Annotations for 1639825_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720