FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639827_at:

>probe:Drosophila_2:1639827_at:706:727; Interrogation_Position=431; Antisense; TTGGCCACGCCACTGGAACGGAAAA
>probe:Drosophila_2:1639827_at:157:377; Interrogation_Position=463; Antisense; GAAGCATCAGTACATCTATCCGGTC
>probe:Drosophila_2:1639827_at:377:201; Interrogation_Position=489; Antisense; AACCGTACTCCCCAATAATTGTCTG
>probe:Drosophila_2:1639827_at:322:181; Interrogation_Position=561; Antisense; AAAAACCCTGCTGCTTCTTCAATGC
>probe:Drosophila_2:1639827_at:143:169; Interrogation_Position=599; Antisense; AAATGGTGGGCCGAACTGCGCTTTC
>probe:Drosophila_2:1639827_at:613:361; Interrogation_Position=630; Antisense; GCAAGGCTGCTCTCAAAGCCAGGAT
>probe:Drosophila_2:1639827_at:403:345; Interrogation_Position=663; Antisense; GCATCCTTAGCCTGTCGAAACCAAA
>probe:Drosophila_2:1639827_at:640:391; Interrogation_Position=679; Antisense; GAAACCAAAGATCACGCCTCAGTTC
>probe:Drosophila_2:1639827_at:494:619; Interrogation_Position=741; Antisense; TGCTTAATGTCAAACCGCCACGGAG
>probe:Drosophila_2:1639827_at:459:375; Interrogation_Position=766; Antisense; GAAGAAGTTTACTCCCCAGGGATGG
>probe:Drosophila_2:1639827_at:295:69; Interrogation_Position=787; Antisense; ATGGCGTCTCCACCAGATCAGATTG
>probe:Drosophila_2:1639827_at:433:687; Interrogation_Position=813; Antisense; TATATCTTTCGAAGCCTGTGTCCCG
>probe:Drosophila_2:1639827_at:563:597; Interrogation_Position=831; Antisense; TGTCCCGGCCCGAATACGAGTATTT
>probe:Drosophila_2:1639827_at:498:685; Interrogation_Position=866; Antisense; TATCGTGTCATATAGCGCCCATAAT

Paste this into a BLAST search page for me
TTGGCCACGCCACTGGAACGGAAAAGAAGCATCAGTACATCTATCCGGTCAACCGTACTCCCCAATAATTGTCTGAAAAACCCTGCTGCTTCTTCAATGCAAATGGTGGGCCGAACTGCGCTTTCGCAAGGCTGCTCTCAAAGCCAGGATGCATCCTTAGCCTGTCGAAACCAAAGAAACCAAAGATCACGCCTCAGTTCTGCTTAATGTCAAACCGCCACGGAGGAAGAAGTTTACTCCCCAGGGATGGATGGCGTCTCCACCAGATCAGATTGTATATCTTTCGAAGCCTGTGTCCCGTGTCCCGGCCCGAATACGAGTATTTTATCGTGTCATATAGCGCCCATAAT

Full Affymetrix probeset data:

Annotations for 1639827_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720