FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639831_at:

>probe:Drosophila_2:1639831_at:192:495; Interrogation_Position=1007; Antisense; GTCACCTGTCATTCTGGTCCAAATT
>probe:Drosophila_2:1639831_at:203:455; Interrogation_Position=1063; Antisense; GTAGCTTTGGCTGTCTACGAAGCGT
>probe:Drosophila_2:1639831_at:620:327; Interrogation_Position=1084; Antisense; GCGTATGACCCGAATGTTGGATCCA
>probe:Drosophila_2:1639831_at:182:49; Interrogation_Position=1114; Antisense; ATCCACCGACAGTTTTGTTTCTTCA
>probe:Drosophila_2:1639831_at:172:37; Interrogation_Position=1162; Antisense; ATCATGAAGGCATCTCCATTTCCAC
>probe:Drosophila_2:1639831_at:437:117; Interrogation_Position=722; Antisense; AGCTAACTTCTGCTCTAAGGGTTTT
>probe:Drosophila_2:1639831_at:338:645; Interrogation_Position=765; Antisense; TCTTCAGGAACTTTGCCTGGGCGAT
>probe:Drosophila_2:1639831_at:53:415; Interrogation_Position=822; Antisense; GACCAAGTTCCATCAGCAAATCATA
>probe:Drosophila_2:1639831_at:543:147; Interrogation_Position=846; Antisense; ACTACTTACAGATCGCTGCAACCAT
>probe:Drosophila_2:1639831_at:506:459; Interrogation_Position=903; Antisense; GATTAACTTTCTGCTCGTCTCATTG
>probe:Drosophila_2:1639831_at:501:337; Interrogation_Position=915; Antisense; GCTCGTCTCATTGTCACTGTTCGAA
>probe:Drosophila_2:1639831_at:579:143; Interrogation_Position=930; Antisense; ACTGTTCGAAGTGCTGGCAGCCAAG
>probe:Drosophila_2:1639831_at:608:123; Interrogation_Position=948; Antisense; AGCCAAGAAGAATCCCCAAGTCGCA
>probe:Drosophila_2:1639831_at:163:475; Interrogation_Position=993; Antisense; GTTAATGACTCTGGGTCACCTGTCA

Paste this into a BLAST search page for me
GTCACCTGTCATTCTGGTCCAAATTGTAGCTTTGGCTGTCTACGAAGCGTGCGTATGACCCGAATGTTGGATCCAATCCACCGACAGTTTTGTTTCTTCAATCATGAAGGCATCTCCATTTCCACAGCTAACTTCTGCTCTAAGGGTTTTTCTTCAGGAACTTTGCCTGGGCGATGACCAAGTTCCATCAGCAAATCATAACTACTTACAGATCGCTGCAACCATGATTAACTTTCTGCTCGTCTCATTGGCTCGTCTCATTGTCACTGTTCGAAACTGTTCGAAGTGCTGGCAGCCAAGAGCCAAGAAGAATCCCCAAGTCGCAGTTAATGACTCTGGGTCACCTGTCA

Full Affymetrix probeset data:

Annotations for 1639831_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720