FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639832_at:

>probe:Drosophila_2:1639832_at:404:91; Interrogation_Position=114; Antisense; AGTTTATGTCGCCAGCTCTAGCAAT
>probe:Drosophila_2:1639832_at:135:241; Interrogation_Position=146; Antisense; AATACATATATTGTGCCGGTCCAGG
>probe:Drosophila_2:1639832_at:527:535; Interrogation_Position=258; Antisense; GGATCCCGTAGGCATAACCACTAAA
>probe:Drosophila_2:1639832_at:495:561; Interrogation_Position=318; Antisense; GGAACCATTGGCGATTACCCTGCGA
>probe:Drosophila_2:1639832_at:683:249; Interrogation_Position=351; Antisense; CAATGCCGGACCATGTTATCCTTAT
>probe:Drosophila_2:1639832_at:240:705; Interrogation_Position=366; Antisense; TTATCCTTATATGGTCTGCTACGAG
>probe:Drosophila_2:1639832_at:155:647; Interrogation_Position=423; Antisense; TCATCTAGTGTCCTGCAATCGCATG
>probe:Drosophila_2:1639832_at:96:69; Interrogation_Position=488; Antisense; ATGGCTTTATGCCACATCCACGGAA
>probe:Drosophila_2:1639832_at:581:83; Interrogation_Position=538; Antisense; AGTGGCTCCAAGCTGGTCCATCGAT
>probe:Drosophila_2:1639832_at:175:269; Interrogation_Position=556; Antisense; CATCGATGCCACTTGAACTACACTT
>probe:Drosophila_2:1639832_at:437:665; Interrogation_Position=574; Antisense; TACACTTGGCACTACGAACGGAGGT
>probe:Drosophila_2:1639832_at:560:623; Interrogation_Position=601; Antisense; TGCGTCCAGCAGTCCGAGAGGATGT
>probe:Drosophila_2:1639832_at:134:437; Interrogation_Position=618; Antisense; GAGGATGTGCTACTCCGAACAACTT
>probe:Drosophila_2:1639832_at:577:375; Interrogation_Position=85; Antisense; GAAGAGTGTGCCAGTGCTCCACAAT

Paste this into a BLAST search page for me
AGTTTATGTCGCCAGCTCTAGCAATAATACATATATTGTGCCGGTCCAGGGGATCCCGTAGGCATAACCACTAAAGGAACCATTGGCGATTACCCTGCGACAATGCCGGACCATGTTATCCTTATTTATCCTTATATGGTCTGCTACGAGTCATCTAGTGTCCTGCAATCGCATGATGGCTTTATGCCACATCCACGGAAAGTGGCTCCAAGCTGGTCCATCGATCATCGATGCCACTTGAACTACACTTTACACTTGGCACTACGAACGGAGGTTGCGTCCAGCAGTCCGAGAGGATGTGAGGATGTGCTACTCCGAACAACTTGAAGAGTGTGCCAGTGCTCCACAAT

Full Affymetrix probeset data:

Annotations for 1639832_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720