FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639833_at:

>probe:Drosophila_2:1639833_at:139:73; Interrogation_Position=141; Antisense; AGGCAATGGCGGCTTGAGCGGCATG
>probe:Drosophila_2:1639833_at:138:291; Interrogation_Position=168; Antisense; CGGTATGGCTGTGGCCGGCGGCTCA
>probe:Drosophila_2:1639833_at:441:1; Interrogation_Position=186; Antisense; CGGCTCAGGAGCACCGCCGTTCGGA
>probe:Drosophila_2:1639833_at:467:553; Interrogation_Position=211; Antisense; GGAGCAGGAGCCTCTGGTTCCTGCA
>probe:Drosophila_2:1639833_at:2:591; Interrogation_Position=225; Antisense; TGGTTCCTGCACACCGGGCGGCAAT
>probe:Drosophila_2:1639833_at:190:261; Interrogation_Position=236; Antisense; CACCGGGCGGCAATGGAACGGCCAT
>probe:Drosophila_2:1639833_at:610:187; Interrogation_Position=265; Antisense; AACACATCCACCTGCGGCAGACATT
>probe:Drosophila_2:1639833_at:174:307; Interrogation_Position=275; Antisense; CCTGCGGCAGACATTATGGTGAGTA
>probe:Drosophila_2:1639833_at:590:405; Interrogation_Position=34; Antisense; GACTCCATCCGCTTCGAGGAAGACT
>probe:Drosophila_2:1639833_at:23:73; Interrogation_Position=50; Antisense; AGGAAGACTCCCTCTGCAGCTGGAG
>probe:Drosophila_2:1639833_at:314:353; Interrogation_Position=65; Antisense; GCAGCTGGAGCTCTGAACCGGAATC
>probe:Drosophila_2:1639833_at:450:337; Interrogation_Position=74; Antisense; GCTCTGAACCGGAATCGCTGTGCAA
>probe:Drosophila_2:1639833_at:305:381; Interrogation_Position=79; Antisense; GAACCGGAATCGCTGTGCAACAACT
>probe:Drosophila_2:1639833_at:14:597; Interrogation_Position=92; Antisense; TGTGCAACAACTGGCGCGGCTGGAA

Paste this into a BLAST search page for me
AGGCAATGGCGGCTTGAGCGGCATGCGGTATGGCTGTGGCCGGCGGCTCACGGCTCAGGAGCACCGCCGTTCGGAGGAGCAGGAGCCTCTGGTTCCTGCATGGTTCCTGCACACCGGGCGGCAATCACCGGGCGGCAATGGAACGGCCATAACACATCCACCTGCGGCAGACATTCCTGCGGCAGACATTATGGTGAGTAGACTCCATCCGCTTCGAGGAAGACTAGGAAGACTCCCTCTGCAGCTGGAGGCAGCTGGAGCTCTGAACCGGAATCGCTCTGAACCGGAATCGCTGTGCAAGAACCGGAATCGCTGTGCAACAACTTGTGCAACAACTGGCGCGGCTGGAA

Full Affymetrix probeset data:

Annotations for 1639833_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720