Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639834_at:

>probe:Drosophila_2:1639834_at:252:711; Interrogation_Position=1312; Antisense; TTCACCCACATTCCAGCAGATATTG
>probe:Drosophila_2:1639834_at:390:111; Interrogation_Position=1353; Antisense; AGCAAACTCTGCCATGGTATCGTTC
>probe:Drosophila_2:1639834_at:227:683; Interrogation_Position=1370; Antisense; TATCGTTCCTTGTTGCAGTACTACC
>probe:Drosophila_2:1639834_at:668:411; Interrogation_Position=1398; Antisense; GACCCGAATGGGAGCTGTACGACAT
>probe:Drosophila_2:1639834_at:229:657; Interrogation_Position=1423; Antisense; TAAGACGGATCCCTTGGAGCGTTTC
>probe:Drosophila_2:1639834_at:397:553; Interrogation_Position=1438; Antisense; GGAGCGTTTCAATCTGGCCGATAAG
>probe:Drosophila_2:1639834_at:714:227; Interrogation_Position=1472; Antisense; AATGGCACCCTGAAGCAGTTACGCG
>probe:Drosophila_2:1639834_at:302:673; Interrogation_Position=1491; Antisense; TACGCGAGCAACTGTTCGACTGGCA
>probe:Drosophila_2:1639834_at:412:75; Interrogation_Position=1563; Antisense; AGGAGCAGGGCGTCTACAAGGATCA
>probe:Drosophila_2:1639834_at:67:253; Interrogation_Position=1630; Antisense; CAAGCGCAGGATTCTCGGTCAGTAT
>probe:Drosophila_2:1639834_at:137:519; Interrogation_Position=1664; Antisense; GTGGTCTTCTCGTAGGTCTGACTAA
>probe:Drosophila_2:1639834_at:490:517; Interrogation_Position=1707; Antisense; GTGTGTTGTCTTATCGCATGTCCAA
>probe:Drosophila_2:1639834_at:379:129; Interrogation_Position=1746; Antisense; ACCATGCCAATGTTTTTCACTTCAC
>probe:Drosophila_2:1639834_at:306:697; Interrogation_Position=1761; Antisense; TTCACTTCACATGCCGTTACAGTTG

Paste this into a BLAST search page for me
TTCACCCACATTCCAGCAGATATTGAGCAAACTCTGCCATGGTATCGTTCTATCGTTCCTTGTTGCAGTACTACCGACCCGAATGGGAGCTGTACGACATTAAGACGGATCCCTTGGAGCGTTTCGGAGCGTTTCAATCTGGCCGATAAGAATGGCACCCTGAAGCAGTTACGCGTACGCGAGCAACTGTTCGACTGGCAAGGAGCAGGGCGTCTACAAGGATCACAAGCGCAGGATTCTCGGTCAGTATGTGGTCTTCTCGTAGGTCTGACTAAGTGTGTTGTCTTATCGCATGTCCAAACCATGCCAATGTTTTTCACTTCACTTCACTTCACATGCCGTTACAGTTG

Full Affymetrix probeset data:

Annotations for 1639834_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime