FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639836_at:

>probe:Drosophila_2:1639836_at:144:97; Interrogation_Position=1021; Antisense; AGATCGTTTCCGTTGAACTACTTCG
>probe:Drosophila_2:1639836_at:297:713; Interrogation_Position=1069; Antisense; TTCACCAACCTTTTGCTGGTCATTT
>probe:Drosophila_2:1639836_at:93:549; Interrogation_Position=1150; Antisense; GGAGGATTGGCCTTTCCATCCAGGA
>probe:Drosophila_2:1639836_at:295:193; Interrogation_Position=1187; Antisense; AACTCAGGCACACTATGCACTTCTA
>probe:Drosophila_2:1639836_at:617:147; Interrogation_Position=1205; Antisense; ACTTCTACGGCCTGTATCTGAAGAA
>probe:Drosophila_2:1639836_at:515:587; Interrogation_Position=1232; Antisense; TGGAGCATGTATTTGCCGTCAGCGC
>probe:Drosophila_2:1639836_at:462:321; Interrogation_Position=1253; Antisense; GCGCCTGTGGACTGTTTAAGCTGAA
>probe:Drosophila_2:1639836_at:203:457; Interrogation_Position=1284; Antisense; GATACTCTTTTGCATCGTGGGTGCA
>probe:Drosophila_2:1639836_at:150:159; Interrogation_Position=825; Antisense; ACAAAAGTGGTTGGCCCTCGAATTG
>probe:Drosophila_2:1639836_at:385:245; Interrogation_Position=875; Antisense; AATTGTTGAAGCTCCATCGGTCCAT
>probe:Drosophila_2:1639836_at:185:25; Interrogation_Position=898; Antisense; ATATGCTCGTTGTGCGCAGTTCAGG
>probe:Drosophila_2:1639836_at:45:269; Interrogation_Position=919; Antisense; CAGGCCGTCTGCTTTTTGGGATTTG
>probe:Drosophila_2:1639836_at:510:543; Interrogation_Position=937; Antisense; GGATTTGTGCCCTTGGAGTGCACGA
>probe:Drosophila_2:1639836_at:477:431; Interrogation_Position=952; Antisense; GAGTGCACGATTCACCTGTTCTTCA

Paste this into a BLAST search page for me
AGATCGTTTCCGTTGAACTACTTCGTTCACCAACCTTTTGCTGGTCATTTGGAGGATTGGCCTTTCCATCCAGGAAACTCAGGCACACTATGCACTTCTAACTTCTACGGCCTGTATCTGAAGAATGGAGCATGTATTTGCCGTCAGCGCGCGCCTGTGGACTGTTTAAGCTGAAGATACTCTTTTGCATCGTGGGTGCAACAAAAGTGGTTGGCCCTCGAATTGAATTGTTGAAGCTCCATCGGTCCATATATGCTCGTTGTGCGCAGTTCAGGCAGGCCGTCTGCTTTTTGGGATTTGGGATTTGTGCCCTTGGAGTGCACGAGAGTGCACGATTCACCTGTTCTTCA

Full Affymetrix probeset data:

Annotations for 1639836_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720