FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639837_at:

>probe:Drosophila_2:1639837_at:627:365; Interrogation_Position=2256; Antisense; GAACCATATCTTTTACGTTAAGTAG
>probe:Drosophila_2:1639837_at:208:179; Interrogation_Position=2376; Antisense; AAACTGCATGCTTTGCTAGATCGAA
>probe:Drosophila_2:1639837_at:370:365; Interrogation_Position=2398; Antisense; GAATCAACACTAATTGGTAGCTCAA
>probe:Drosophila_2:1639837_at:69:557; Interrogation_Position=2424; Antisense; GGACGATTTGCATTAGACTAAGCTG
>probe:Drosophila_2:1639837_at:163:35; Interrogation_Position=2453; Antisense; ATCAGGTCGTGGAAATGAGGCTTTA
>probe:Drosophila_2:1639837_at:697:437; Interrogation_Position=2469; Antisense; GAGGCTTTAGCTCCAAATATACACA
>probe:Drosophila_2:1639837_at:109:205; Interrogation_Position=2549; Antisense; AAGCCTGAATGGGTGTGAGCAAGCA
>probe:Drosophila_2:1639837_at:419:595; Interrogation_Position=2604; Antisense; TGTGTTTTTGAGTGAATGCTTTCCA
>probe:Drosophila_2:1639837_at:256:43; Interrogation_Position=2619; Antisense; ATGCTTTCCAAAAATCTCGTACGTA
>probe:Drosophila_2:1639837_at:114:493; Interrogation_Position=2641; Antisense; GTAACCCCAATTTTCTATGTCTATA
>probe:Drosophila_2:1639837_at:688:59; Interrogation_Position=2657; Antisense; ATGTCTATACTTTGGCTCTTATCGG
>probe:Drosophila_2:1639837_at:38:571; Interrogation_Position=2670; Antisense; GGCTCTTATCGGCATTTTTGTACAC
>probe:Drosophila_2:1639837_at:630:675; Interrogation_Position=2701; Antisense; TAGCTTGTTTAAGTGTCCTTACCAA
>probe:Drosophila_2:1639837_at:147:231; Interrogation_Position=2743; Antisense; AATCTTTTCGATTCATTGCTAAATT

Paste this into a BLAST search page for me
GAACCATATCTTTTACGTTAAGTAGAAACTGCATGCTTTGCTAGATCGAAGAATCAACACTAATTGGTAGCTCAAGGACGATTTGCATTAGACTAAGCTGATCAGGTCGTGGAAATGAGGCTTTAGAGGCTTTAGCTCCAAATATACACAAAGCCTGAATGGGTGTGAGCAAGCATGTGTTTTTGAGTGAATGCTTTCCAATGCTTTCCAAAAATCTCGTACGTAGTAACCCCAATTTTCTATGTCTATAATGTCTATACTTTGGCTCTTATCGGGGCTCTTATCGGCATTTTTGTACACTAGCTTGTTTAAGTGTCCTTACCAAAATCTTTTCGATTCATTGCTAAATT

Full Affymetrix probeset data:

Annotations for 1639837_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720