FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639838_at:

>probe:Drosophila_2:1639838_at:235:319; Interrogation_Position=1293; Antisense; GCCGAGTTCGAGAAGTCCGTACACA
>probe:Drosophila_2:1639838_at:61:117; Interrogation_Position=1318; Antisense; AGCATACCATACTACGCACCTATAT
>probe:Drosophila_2:1639838_at:728:419; Interrogation_Position=1427; Antisense; GAGCACCAAGAAACCCAGTCGTGGA
>probe:Drosophila_2:1639838_at:589:87; Interrogation_Position=1443; Antisense; AGTCGTGGATGGAGCCTTCTAACCT
>probe:Drosophila_2:1639838_at:703:129; Interrogation_Position=1464; Antisense; ACCTGGCGTGGTTGAGCTTTAAATC
>probe:Drosophila_2:1639838_at:265:239; Interrogation_Position=1485; Antisense; AATCTTGCCAATCCATTTGCCAATC
>probe:Drosophila_2:1639838_at:212:51; Interrogation_Position=1514; Antisense; ATGCCGCTCAATGTATTAGGCCATT
>probe:Drosophila_2:1639838_at:417:681; Interrogation_Position=1548; Antisense; TATGTAGTGCCATTAGCCAACCACC
>probe:Drosophila_2:1639838_at:88:465; Interrogation_Position=1612; Antisense; GTGAAACCCCTAGCAAATCCTATTT
>probe:Drosophila_2:1639838_at:18:477; Interrogation_Position=1672; Antisense; GTTTCACTTCTTTGGAATTCCGGCT
>probe:Drosophila_2:1639838_at:466:247; Interrogation_Position=1687; Antisense; AATTCCGGCTTGTTGGTGCCAGAAC
>probe:Drosophila_2:1639838_at:206:331; Interrogation_Position=1730; Antisense; GCGGACGATTCATGCCACAGACGAA
>probe:Drosophila_2:1639838_at:371:725; Interrogation_Position=1758; Antisense; TTGTATCAAATGTTTGCCACCCACC
>probe:Drosophila_2:1639838_at:313:289; Interrogation_Position=1813; Antisense; CGGCATTCAACATCGATCAGCTAGT

Paste this into a BLAST search page for me
GCCGAGTTCGAGAAGTCCGTACACAAGCATACCATACTACGCACCTATATGAGCACCAAGAAACCCAGTCGTGGAAGTCGTGGATGGAGCCTTCTAACCTACCTGGCGTGGTTGAGCTTTAAATCAATCTTGCCAATCCATTTGCCAATCATGCCGCTCAATGTATTAGGCCATTTATGTAGTGCCATTAGCCAACCACCGTGAAACCCCTAGCAAATCCTATTTGTTTCACTTCTTTGGAATTCCGGCTAATTCCGGCTTGTTGGTGCCAGAACGCGGACGATTCATGCCACAGACGAATTGTATCAAATGTTTGCCACCCACCCGGCATTCAACATCGATCAGCTAGT

Full Affymetrix probeset data:

Annotations for 1639838_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720