FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639840_at:

>probe:Drosophila_2:1639840_at:38:179; Interrogation_Position=112; Antisense; AAACTGCTTTATACCTTTCGAGTGG
>probe:Drosophila_2:1639840_at:585:433; Interrogation_Position=131; Antisense; GAGTGGTTAAACTGGCACCTGCTTT
>probe:Drosophila_2:1639840_at:213:131; Interrogation_Position=147; Antisense; ACCTGCTTTCACCATCGATATAACA
>probe:Drosophila_2:1639840_at:501:591; Interrogation_Position=226; Antisense; TGTGACTTTCTGAACAATCCGCTGC
>probe:Drosophila_2:1639840_at:368:235; Interrogation_Position=241; Antisense; AATCCGCTGCTGTTCAAAATGTTTG
>probe:Drosophila_2:1639840_at:178:227; Interrogation_Position=26; Antisense; AAGGCAACATCGAGTTCATTCTGGA
>probe:Drosophila_2:1639840_at:497:647; Interrogation_Position=279; Antisense; TCACCTCGTGGTCAATGGCAGTTAC
>probe:Drosophila_2:1639840_at:547:349; Interrogation_Position=296; Antisense; GCAGTTACTTTAAGTGCCCCATCAA
>probe:Drosophila_2:1639840_at:119:87; Interrogation_Position=308; Antisense; AGTGCCCCATCAAGCCAAAGGTTTA
>probe:Drosophila_2:1639840_at:88:539; Interrogation_Position=349; Antisense; GGTACGGTGTCAATAATTCCCAGCA
>probe:Drosophila_2:1639840_at:476:289; Interrogation_Position=388; Antisense; CGGTTCCAGTTGTCGATGCGTGTGA
>probe:Drosophila_2:1639840_at:401:219; Interrogation_Position=423; Antisense; AAGTCGAGCGCCATTCGTTATGGAA
>probe:Drosophila_2:1639840_at:411:499; Interrogation_Position=51; Antisense; GTCTCTGGAGACGAACTGTGACCAC
>probe:Drosophila_2:1639840_at:436:429; Interrogation_Position=85; Antisense; GAGTATTTCCGCAAAGTTCCAAACA

Paste this into a BLAST search page for me
AAACTGCTTTATACCTTTCGAGTGGGAGTGGTTAAACTGGCACCTGCTTTACCTGCTTTCACCATCGATATAACATGTGACTTTCTGAACAATCCGCTGCAATCCGCTGCTGTTCAAAATGTTTGAAGGCAACATCGAGTTCATTCTGGATCACCTCGTGGTCAATGGCAGTTACGCAGTTACTTTAAGTGCCCCATCAAAGTGCCCCATCAAGCCAAAGGTTTAGGTACGGTGTCAATAATTCCCAGCACGGTTCCAGTTGTCGATGCGTGTGAAAGTCGAGCGCCATTCGTTATGGAAGTCTCTGGAGACGAACTGTGACCACGAGTATTTCCGCAAAGTTCCAAACA

Full Affymetrix probeset data:

Annotations for 1639840_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720