FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639841_at:

>probe:Drosophila_2:1639841_at:294:595; Interrogation_Position=1085; Antisense; TGGGCTCCACCAAGACTGGGCGCAA
>probe:Drosophila_2:1639841_at:218:491; Interrogation_Position=1132; Antisense; GTCACCTCGGAGTTGGACGGTAACG
>probe:Drosophila_2:1639841_at:390:21; Interrogation_Position=1162; Antisense; ATAGTTGCCGAGCACGTTGTCGTCG
>probe:Drosophila_2:1639841_at:559:461; Interrogation_Position=1177; Antisense; GTTGTCGTCGAGGATACTTCGTCCA
>probe:Drosophila_2:1639841_at:557:27; Interrogation_Position=1190; Antisense; ATACTTCGTCCAAGGCGCCAAAGAA
>probe:Drosophila_2:1639841_at:231:227; Interrogation_Position=1292; Antisense; AATGGATATCGTAAGTACTGTCCCC
>probe:Drosophila_2:1639841_at:361:707; Interrogation_Position=758; Antisense; TTAAGTTCGACGAGTTCCCGCACCT
>probe:Drosophila_2:1639841_at:623:43; Interrogation_Position=783; Antisense; ATCGCCGCACAATCAGATTCACGGA
>probe:Drosophila_2:1639841_at:275:463; Interrogation_Position=798; Antisense; GATTCACGGACAGGCGGTCAATCTG
>probe:Drosophila_2:1639841_at:168:47; Interrogation_Position=924; Antisense; ATCCGCATCCGCCATAAGCACAAAT
>probe:Drosophila_2:1639841_at:536:33; Interrogation_Position=947; Antisense; ATCAATCTCTCGGATCGGGTTTGGT
>probe:Drosophila_2:1639841_at:538:479; Interrogation_Position=965; Antisense; GTTTGGTGGATCAACGGGCCAGATC
>probe:Drosophila_2:1639841_at:442:97; Interrogation_Position=985; Antisense; AGATCGCCCAAGAGTTGCTCCAGTG
>probe:Drosophila_2:1639841_at:717:93; Interrogation_Position=997; Antisense; AGTTGCTCCAGTGCAGCGATGCCAG

Paste this into a BLAST search page for me
TGGGCTCCACCAAGACTGGGCGCAAGTCACCTCGGAGTTGGACGGTAACGATAGTTGCCGAGCACGTTGTCGTCGGTTGTCGTCGAGGATACTTCGTCCAATACTTCGTCCAAGGCGCCAAAGAAAATGGATATCGTAAGTACTGTCCCCTTAAGTTCGACGAGTTCCCGCACCTATCGCCGCACAATCAGATTCACGGAGATTCACGGACAGGCGGTCAATCTGATCCGCATCCGCCATAAGCACAAATATCAATCTCTCGGATCGGGTTTGGTGTTTGGTGGATCAACGGGCCAGATCAGATCGCCCAAGAGTTGCTCCAGTGAGTTGCTCCAGTGCAGCGATGCCAG

Full Affymetrix probeset data:

Annotations for 1639841_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720