FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639842_at:

>probe:Drosophila_2:1639842_at:21:79; Interrogation_Position=1032; Antisense; AGGATCCACACCGAGTGCTTGAGGT
>probe:Drosophila_2:1639842_at:462:619; Interrogation_Position=1062; Antisense; TGCTCGACTTTCAGCTGATACGCTA
>probe:Drosophila_2:1639842_at:6:559; Interrogation_Position=1102; Antisense; GGACATTGCCAATCTGCTGTACTGC
>probe:Drosophila_2:1639842_at:691:487; Interrogation_Position=1120; Antisense; GTACTGCTGCACCACCAAGGAAATG
>probe:Drosophila_2:1639842_at:353:395; Interrogation_Position=1139; Antisense; GAAATGCGCGATGCTCAGCTGCAGA
>probe:Drosophila_2:1639842_at:162:419; Interrogation_Position=1187; Antisense; GAGCTGTTTCGATGGCTGCAAATGC
>probe:Drosophila_2:1639842_at:505:167; Interrogation_Position=1206; Antisense; AAATGCTCTGCACAAATTTGCCGGA
>probe:Drosophila_2:1639842_at:420:377; Interrogation_Position=1249; Antisense; GAAGCTGCAGGATCTTTTTGCCGAG
>probe:Drosophila_2:1639842_at:90:377; Interrogation_Position=1279; Antisense; GAAGACATACGGACGCTTTGCACTT
>probe:Drosophila_2:1639842_at:662:13; Interrogation_Position=1328; Antisense; ATTAGCACCTGCTCTTCGGAGGATG
>probe:Drosophila_2:1639842_at:460:519; Interrogation_Position=1472; Antisense; GTGGATCGGGACATGCTCTAGGCCA
>probe:Drosophila_2:1639842_at:283:229; Interrogation_Position=1509; Antisense; AATGGAACACTAGCTGTCAGCCCAA
>probe:Drosophila_2:1639842_at:425:241; Interrogation_Position=1550; Antisense; AATACACCGTGCTCCAGTTGATGCT
>probe:Drosophila_2:1639842_at:394:95; Interrogation_Position=1565; Antisense; AGTTGATGCTCACTTAACCCTTAGT

Paste this into a BLAST search page for me
AGGATCCACACCGAGTGCTTGAGGTTGCTCGACTTTCAGCTGATACGCTAGGACATTGCCAATCTGCTGTACTGCGTACTGCTGCACCACCAAGGAAATGGAAATGCGCGATGCTCAGCTGCAGAGAGCTGTTTCGATGGCTGCAAATGCAAATGCTCTGCACAAATTTGCCGGAGAAGCTGCAGGATCTTTTTGCCGAGGAAGACATACGGACGCTTTGCACTTATTAGCACCTGCTCTTCGGAGGATGGTGGATCGGGACATGCTCTAGGCCAAATGGAACACTAGCTGTCAGCCCAAAATACACCGTGCTCCAGTTGATGCTAGTTGATGCTCACTTAACCCTTAGT

Full Affymetrix probeset data:

Annotations for 1639842_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720