FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639843_at:

>probe:Drosophila_2:1639843_at:176:607; Interrogation_Position=1390; Antisense; TGAGTTCGCTGTCCGTGTATCTAAA
>probe:Drosophila_2:1639843_at:468:481; Interrogation_Position=1406; Antisense; GTATCTAAACTCAACGTCACTGGTG
>probe:Drosophila_2:1639843_at:15:275; Interrogation_Position=1508; Antisense; CATTGTTGTATTGGGACTTCTCGCG
>probe:Drosophila_2:1639843_at:468:693; Interrogation_Position=1533; Antisense; TTTGCCATGGTATTCGTCCTTGAGA
>probe:Drosophila_2:1639843_at:409:607; Interrogation_Position=1561; Antisense; TGAGTGGCGTCCTTAGCATATCCGT
>probe:Drosophila_2:1639843_at:189:539; Interrogation_Position=1635; Antisense; GGTATGCTGGTTCCTTGGGCAAATA
>probe:Drosophila_2:1639843_at:706:525; Interrogation_Position=1651; Antisense; GGGCAAATACAGTCGGCACGGCAGT
>probe:Drosophila_2:1639843_at:409:269; Interrogation_Position=1682; Antisense; CATCGCCAGTGTTCTGCTAACAGGA
>probe:Drosophila_2:1639843_at:549:23; Interrogation_Position=1710; Antisense; ATATCCTTCGGATCTCAGTTCGCTG
>probe:Drosophila_2:1639843_at:92:717; Interrogation_Position=1728; Antisense; TTCGCTGCGGCATCGGGACAACTGG
>probe:Drosophila_2:1639843_at:271:53; Interrogation_Position=1784; Antisense; ATGCTTGGCCAATGCTAGTGTTGCT
>probe:Drosophila_2:1639843_at:587:621; Interrogation_Position=1805; Antisense; TGCTGAAAACGCTTGGGTGGCCGAA
>probe:Drosophila_2:1639843_at:203:315; Interrogation_Position=1824; Antisense; GCCGAAGAGGAGGTGTTCCCACTTT
>probe:Drosophila_2:1639843_at:603:41; Interrogation_Position=1878; Antisense; ATCGGAGTGCTTACAGTCGTCGTTG

Paste this into a BLAST search page for me
TGAGTTCGCTGTCCGTGTATCTAAAGTATCTAAACTCAACGTCACTGGTGCATTGTTGTATTGGGACTTCTCGCGTTTGCCATGGTATTCGTCCTTGAGATGAGTGGCGTCCTTAGCATATCCGTGGTATGCTGGTTCCTTGGGCAAATAGGGCAAATACAGTCGGCACGGCAGTCATCGCCAGTGTTCTGCTAACAGGAATATCCTTCGGATCTCAGTTCGCTGTTCGCTGCGGCATCGGGACAACTGGATGCTTGGCCAATGCTAGTGTTGCTTGCTGAAAACGCTTGGGTGGCCGAAGCCGAAGAGGAGGTGTTCCCACTTTATCGGAGTGCTTACAGTCGTCGTTG

Full Affymetrix probeset data:

Annotations for 1639843_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720