FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639845_at:

>probe:Drosophila_2:1639845_at:427:575; Interrogation_Position=261; Antisense; GGCGCACTGTTTTGAGGACCGAGCA
>probe:Drosophila_2:1639845_at:43:583; Interrogation_Position=312; Antisense; TGGCATCTCCAGACTCAGCGAAAAA
>probe:Drosophila_2:1639845_at:126:345; Interrogation_Position=338; Antisense; GCATTCGTCGTCAAGTTAAGCGCTT
>probe:Drosophila_2:1639845_at:102:659; Interrogation_Position=354; Antisense; TAAGCGCTTCATTAAGTCGGCCCAG
>probe:Drosophila_2:1639845_at:690:407; Interrogation_Position=403; Antisense; GACGTGGCTGTGGTGCTACTGAATC
>probe:Drosophila_2:1639845_at:309:41; Interrogation_Position=448; Antisense; ATCGGAACTCTATCCTTGTGCAGTA
>probe:Drosophila_2:1639845_at:598:89; Interrogation_Position=469; Antisense; AGTACGGCCTTGACTCCGGGACAGA
>probe:Drosophila_2:1639845_at:373:637; Interrogation_Position=606; Antisense; TCGGGAATCAGTCTCCATATCGGAT
>probe:Drosophila_2:1639845_at:45:545; Interrogation_Position=627; Antisense; GGATAGCATGTTTTGTGCCTCAGTT
>probe:Drosophila_2:1639845_at:440:169; Interrogation_Position=660; Antisense; AAAGGATGCTTGCACCTACGACTCA
>probe:Drosophila_2:1639845_at:107:397; Interrogation_Position=679; Antisense; GACTCAGGAGGTCCCTTGGTTTACG
>probe:Drosophila_2:1639845_at:291:161; Interrogation_Position=708; Antisense; ACAAGTCTGCGGCATTGTGTCCTTT
>probe:Drosophila_2:1639845_at:515:115; Interrogation_Position=748; Antisense; AGCAGGCGTTATCCCGGTGTCTATA
>probe:Drosophila_2:1639845_at:592:169; Interrogation_Position=805; Antisense; AAAGGCATCAAAGCTTTGCTCTCCC

Paste this into a BLAST search page for me
GGCGCACTGTTTTGAGGACCGAGCATGGCATCTCCAGACTCAGCGAAAAAGCATTCGTCGTCAAGTTAAGCGCTTTAAGCGCTTCATTAAGTCGGCCCAGGACGTGGCTGTGGTGCTACTGAATCATCGGAACTCTATCCTTGTGCAGTAAGTACGGCCTTGACTCCGGGACAGATCGGGAATCAGTCTCCATATCGGATGGATAGCATGTTTTGTGCCTCAGTTAAAGGATGCTTGCACCTACGACTCAGACTCAGGAGGTCCCTTGGTTTACGACAAGTCTGCGGCATTGTGTCCTTTAGCAGGCGTTATCCCGGTGTCTATAAAAGGCATCAAAGCTTTGCTCTCCC

Full Affymetrix probeset data:

Annotations for 1639845_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720