FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639846_at:

>probe:Drosophila_2:1639846_at:184:535; Interrogation_Position=336; Antisense; GGTCTGTCCTGCATCATTATGATCC
>probe:Drosophila_2:1639846_at:247:15; Interrogation_Position=351; Antisense; ATTATGATCCTGTCGGCGCAGCAAA
>probe:Drosophila_2:1639846_at:115:647; Interrogation_Position=386; Antisense; TCTTGGGAACTTTGATGCCGTGTGC
>probe:Drosophila_2:1639846_at:438:543; Interrogation_Position=420; Antisense; GGATTTGGCTCGAGCACCTGGACCA
>probe:Drosophila_2:1639846_at:387:43; Interrogation_Position=444; Antisense; ATCGACCTGTGCTATCTGCTGATGC
>probe:Drosophila_2:1639846_at:204:431; Interrogation_Position=486; Antisense; GAGTACTTCACCCAAACGCTCGGGA
>probe:Drosophila_2:1639846_at:436:139; Interrogation_Position=534; Antisense; ACGTACTACTCCAAGATCATCGACA
>probe:Drosophila_2:1639846_at:111:523; Interrogation_Position=598; Antisense; GGGCCCATGGACTGCGCGTTGAACA
>probe:Drosophila_2:1639846_at:648:467; Interrogation_Position=615; Antisense; GTTGAACAGCGCACCGTGGACATGG
>probe:Drosophila_2:1639846_at:280:401; Interrogation_Position=633; Antisense; GACATGGAGGTCATTCTGCGGCATT
>probe:Drosophila_2:1639846_at:183:597; Interrogation_Position=715; Antisense; TGTGCAAGCGCAATGTCCTAGAGAA
>probe:Drosophila_2:1639846_at:530:107; Interrogation_Position=736; Antisense; AGAAGTTCGGGTATGCCGGACACTA
>probe:Drosophila_2:1639846_at:288:399; Interrogation_Position=754; Antisense; GACACTATGTGGTGCTCTGCGGATA
>probe:Drosophila_2:1639846_at:596:435; Interrogation_Position=816; Antisense; GAGGTCCACGATGGCCACATTTGTC

Paste this into a BLAST search page for me
GGTCTGTCCTGCATCATTATGATCCATTATGATCCTGTCGGCGCAGCAAATCTTGGGAACTTTGATGCCGTGTGCGGATTTGGCTCGAGCACCTGGACCAATCGACCTGTGCTATCTGCTGATGCGAGTACTTCACCCAAACGCTCGGGAACGTACTACTCCAAGATCATCGACAGGGCCCATGGACTGCGCGTTGAACAGTTGAACAGCGCACCGTGGACATGGGACATGGAGGTCATTCTGCGGCATTTGTGCAAGCGCAATGTCCTAGAGAAAGAAGTTCGGGTATGCCGGACACTAGACACTATGTGGTGCTCTGCGGATAGAGGTCCACGATGGCCACATTTGTC

Full Affymetrix probeset data:

Annotations for 1639846_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720