Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639848_at:

>probe:Drosophila_2:1639848_at:272:617; Interrogation_Position=2066; Antisense; TGCACGAAGACTTTTCGCCAGCGCG
>probe:Drosophila_2:1639848_at:371:193; Interrogation_Position=2138; Antisense; AACTCGCGTCTCATGATGCAGATGC
>probe:Drosophila_2:1639848_at:449:373; Interrogation_Position=2164; Antisense; GAAGTTCCAACTGGAGACGGCCGCT
>probe:Drosophila_2:1639848_at:229:299; Interrogation_Position=2185; Antisense; CGCTGCGCAGAAGGCTCAAAGTCAT
>probe:Drosophila_2:1639848_at:319:651; Interrogation_Position=2200; Antisense; TCAAAGTCATAATCCCGAGCAGCAG
>probe:Drosophila_2:1639848_at:629:461; Interrogation_Position=2277; Antisense; GATTCATGTCGACTGAGCCAAGCGT
>probe:Drosophila_2:1639848_at:376:311; Interrogation_Position=2294; Antisense; CCAAGCGTCGCGGAGATGCAGTACT
>probe:Drosophila_2:1639848_at:327:53; Interrogation_Position=2309; Antisense; ATGCAGTACTCTATTACGCCGGAGC
>probe:Drosophila_2:1639848_at:211:595; Interrogation_Position=2349; Antisense; TGTGTGTGCCCATTGACGAGGTCAA
>probe:Drosophila_2:1639848_at:201:189; Interrogation_Position=2375; Antisense; AACAGTTTCTTTATGTCGCACTACA
>probe:Drosophila_2:1639848_at:69:153; Interrogation_Position=2397; Antisense; ACATGCAAGCTGTCCCCATGGAGGA
>probe:Drosophila_2:1639848_at:373:23; Interrogation_Position=2439; Antisense; ATATCATTGTCTTCGAGCAGCCAGG
>probe:Drosophila_2:1639848_at:174:505; Interrogation_Position=2482; Antisense; GTCCATTTACGATCAGCAACAGGTT
>probe:Drosophila_2:1639848_at:696:249; Interrogation_Position=2514; Antisense; CAATGCATGAGAGCGGCGTGCCCAA

Paste this into a BLAST search page for me
TGCACGAAGACTTTTCGCCAGCGCGAACTCGCGTCTCATGATGCAGATGCGAAGTTCCAACTGGAGACGGCCGCTCGCTGCGCAGAAGGCTCAAAGTCATTCAAAGTCATAATCCCGAGCAGCAGGATTCATGTCGACTGAGCCAAGCGTCCAAGCGTCGCGGAGATGCAGTACTATGCAGTACTCTATTACGCCGGAGCTGTGTGTGCCCATTGACGAGGTCAAAACAGTTTCTTTATGTCGCACTACAACATGCAAGCTGTCCCCATGGAGGAATATCATTGTCTTCGAGCAGCCAGGGTCCATTTACGATCAGCAACAGGTTCAATGCATGAGAGCGGCGTGCCCAA

Full Affymetrix probeset data:

Annotations for 1639848_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime