FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639850_at:

>probe:Drosophila_2:1639850_at:93:525; Interrogation_Position=1001; Antisense; GGGATTGTCGCTTCAGGACCCACCG
>probe:Drosophila_2:1639850_at:83:301; Interrogation_Position=1024; Antisense; CGCCGCACACTGGAAACAGCATTTT
>probe:Drosophila_2:1639850_at:127:689; Interrogation_Position=1045; Antisense; TTTTCCTAATGGCACCTAGTCTGGT
>probe:Drosophila_2:1639850_at:729:409; Interrogation_Position=1113; Antisense; GACGCGAAGGGCACCGCCGAAGAAC
>probe:Drosophila_2:1639850_at:358:181; Interrogation_Position=1138; Antisense; AAAACTTCCACAGCTTCGTGCAGAA
>probe:Drosophila_2:1639850_at:391:73; Interrogation_Position=1204; Antisense; AGGAACAGGAACAGGCTCAGCCGTA
>probe:Drosophila_2:1639850_at:619:541; Interrogation_Position=1236; Antisense; GGATTGTGATCCTCGATGGCTATGG
>probe:Drosophila_2:1639850_at:551:67; Interrogation_Position=1251; Antisense; ATGGCTATGGATTTCGTGATTTCGA
>probe:Drosophila_2:1639850_at:516:25; Interrogation_Position=1320; Antisense; ATAGTGTGTGTTCGTCACTTGCACC
>probe:Drosophila_2:1639850_at:122:151; Interrogation_Position=1336; Antisense; ACTTGCACCTCCGATATTTGGTTTG
>probe:Drosophila_2:1639850_at:523:65; Interrogation_Position=1366; Antisense; ATGGACTTAGTTTAGCTTTGCAAAT
>probe:Drosophila_2:1639850_at:583:543; Interrogation_Position=1414; Antisense; GGATATATCCCGCTCGTAAATGTAA
>probe:Drosophila_2:1639850_at:18:313; Interrogation_Position=1445; Antisense; GCCTCATACTTTGCGTAACTTACTC
>probe:Drosophila_2:1639850_at:45:99; Interrogation_Position=940; Antisense; AGAGTGCGACGGGTCCAAAGCCAGT

Paste this into a BLAST search page for me
GGGATTGTCGCTTCAGGACCCACCGCGCCGCACACTGGAAACAGCATTTTTTTTCCTAATGGCACCTAGTCTGGTGACGCGAAGGGCACCGCCGAAGAACAAAACTTCCACAGCTTCGTGCAGAAAGGAACAGGAACAGGCTCAGCCGTAGGATTGTGATCCTCGATGGCTATGGATGGCTATGGATTTCGTGATTTCGAATAGTGTGTGTTCGTCACTTGCACCACTTGCACCTCCGATATTTGGTTTGATGGACTTAGTTTAGCTTTGCAAATGGATATATCCCGCTCGTAAATGTAAGCCTCATACTTTGCGTAACTTACTCAGAGTGCGACGGGTCCAAAGCCAGT

Full Affymetrix probeset data:

Annotations for 1639850_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720