FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639851_at:

>probe:Drosophila_2:1639851_at:591:617; Interrogation_Position=117; Antisense; TGCTCCGGCGGCTGCGGTTTACAGC
>probe:Drosophila_2:1639851_at:502:283; Interrogation_Position=128; Antisense; CTGCGGTTTACAGCCGGGAATACCA
>probe:Drosophila_2:1639851_at:144:709; Interrogation_Position=135; Antisense; TTACAGCCGGGAATACCACGGAAAT
>probe:Drosophila_2:1639851_at:201:363; Interrogation_Position=145; Antisense; GAATACCACGGAAATTTTGCGGCTC
>probe:Drosophila_2:1639851_at:473:671; Interrogation_Position=148; Antisense; TACCACGGAAATTTTGCGGCTCCCT
>probe:Drosophila_2:1639851_at:519:249; Interrogation_Position=151; Antisense; CACGGAAATTTTGCGGCTCCCTACG
>probe:Drosophila_2:1639851_at:490:393; Interrogation_Position=155; Antisense; GAAATTTTGCGGCTCCCTACGTGGC
>probe:Drosophila_2:1639851_at:431:245; Interrogation_Position=157; Antisense; AATTTTGCGGCTCCCTACGTGGCAT
>probe:Drosophila_2:1639851_at:245:671; Interrogation_Position=172; Antisense; TACGTGGCATCTCCCTATGTGGCTT
>probe:Drosophila_2:1639851_at:359:291; Interrogation_Position=174; Antisense; CGTGGCATCTCCCTATGTGGCTTCT
>probe:Drosophila_2:1639851_at:508:595; Interrogation_Position=189; Antisense; TGTGGCTTCTCCCTACGTGGCTTCT
>probe:Drosophila_2:1639851_at:249:669; Interrogation_Position=217; Antisense; TACGTCGCTTCCCCTTACGTGGCGT
>probe:Drosophila_2:1639851_at:305:703; Interrogation_Position=225; Antisense; TTCCCCTTACGTGGCGTCTCCGTAT
>probe:Drosophila_2:1639851_at:456:279; Interrogation_Position=93; Antisense; CTACTCCGCACCTCTGGTGGCTGCT

Paste this into a BLAST search page for me
TGCTCCGGCGGCTGCGGTTTACAGCCTGCGGTTTACAGCCGGGAATACCATTACAGCCGGGAATACCACGGAAATGAATACCACGGAAATTTTGCGGCTCTACCACGGAAATTTTGCGGCTCCCTCACGGAAATTTTGCGGCTCCCTACGGAAATTTTGCGGCTCCCTACGTGGCAATTTTGCGGCTCCCTACGTGGCATTACGTGGCATCTCCCTATGTGGCTTCGTGGCATCTCCCTATGTGGCTTCTTGTGGCTTCTCCCTACGTGGCTTCTTACGTCGCTTCCCCTTACGTGGCGTTTCCCCTTACGTGGCGTCTCCGTATCTACTCCGCACCTCTGGTGGCTGCT

Full Affymetrix probeset data:

Annotations for 1639851_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720